ID: 1168095173

View in Genome Browser
Species Human (GRCh38)
Location 19:54110290-54110312
Sequence GTCCTGAGTGCCCTCCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 220}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168095166_1168095173 -4 Left 1168095166 19:54110271-54110293 CCCCTCTCACCATGCCACAGTCC 0: 1
1: 0
2: 1
3: 39
4: 497
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220
1168095163_1168095173 6 Left 1168095163 19:54110261-54110283 CCCTCCGGCTCCCCTCTCACCAT 0: 1
1: 0
2: 0
3: 36
4: 332
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220
1168095162_1168095173 10 Left 1168095162 19:54110257-54110279 CCATCCCTCCGGCTCCCCTCTCA 0: 1
1: 1
2: 2
3: 84
4: 860
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220
1168095164_1168095173 5 Left 1168095164 19:54110262-54110284 CCTCCGGCTCCCCTCTCACCATG 0: 1
1: 1
2: 2
3: 26
4: 316
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220
1168095159_1168095173 18 Left 1168095159 19:54110249-54110271 CCACCTTCCCATCCCTCCGGCTC 0: 1
1: 0
2: 1
3: 75
4: 881
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220
1168095168_1168095173 -6 Left 1168095168 19:54110273-54110295 CCTCTCACCATGCCACAGTCCTG 0: 1
1: 0
2: 1
3: 37
4: 429
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220
1168095157_1168095173 22 Left 1168095157 19:54110245-54110267 CCTTCCACCTTCCCATCCCTCCG 0: 1
1: 0
2: 13
3: 245
4: 2264
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220
1168095160_1168095173 15 Left 1168095160 19:54110252-54110274 CCTTCCCATCCCTCCGGCTCCCC 0: 1
1: 0
2: 4
3: 109
4: 1492
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220
1168095156_1168095173 30 Left 1168095156 19:54110237-54110259 CCTGAGGTCCTTCCACCTTCCCA 0: 1
1: 1
2: 3
3: 26
4: 341
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220
1168095165_1168095173 2 Left 1168095165 19:54110265-54110287 CCGGCTCCCCTCTCACCATGCCA 0: 1
1: 0
2: 3
3: 58
4: 622
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220
1168095167_1168095173 -5 Left 1168095167 19:54110272-54110294 CCCTCTCACCATGCCACAGTCCT 0: 1
1: 0
2: 3
3: 35
4: 579
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220
1168095161_1168095173 11 Left 1168095161 19:54110256-54110278 CCCATCCCTCCGGCTCCCCTCTC 0: 1
1: 0
2: 3
3: 58
4: 762
Right 1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168095173 Original CRISPR GTCCTGAGTGCCCTCCAGTG GGG Intronic
900103580 1:972965-972987 GTCCTCAGTGCCATCCACCGTGG + Exonic
900152586 1:1185114-1185136 GTCCACTGTGCCCTCCAGTCTGG + Intronic
900824380 1:4914303-4914325 GACCTGAGTGTCCTCCAGCAGGG - Intergenic
901053208 1:6436077-6436099 TTCCTGAGTTCCCAGCAGTGAGG + Intronic
901237687 1:7676263-7676285 GTCCTATGTGACCTCCACTGTGG + Intronic
902481044 1:16712009-16712031 TTCCTGAGTTCCCAGCAGTGAGG - Intergenic
902704319 1:18193937-18193959 TTCCTGAATGTCCTCAAGTGTGG - Intronic
903570509 1:24301062-24301084 GCCCTGAGTGCCCTCCCAGGGGG - Intergenic
904036355 1:27561204-27561226 GGCCCTAGAGCCCTCCAGTGGGG + Intronic
904474310 1:30755057-30755079 GTCCTCAGTTGACTCCAGTGGGG - Intronic
904815457 1:33193398-33193420 GTCCTGTGTGCCCTGCATTGTGG - Intergenic
905650221 1:39651328-39651350 GTGCTGAGTGCTTGCCAGTGTGG - Intergenic
905865214 1:41372719-41372741 GCCCTGAGAGACCTCCAGAGAGG - Intronic
907444945 1:54501486-54501508 TCCCTCAGTGGCCTCCAGTGAGG - Intergenic
908617261 1:65936158-65936180 CTCCTGAAGACCCTCCAGTGGGG - Intronic
912008226 1:104930500-104930522 GTCCTGAGTTCCCTTCACTGTGG + Intergenic
913053760 1:115139068-115139090 GACCAGAGTGCCCTCTAGCGGGG - Intergenic
913497324 1:119440258-119440280 GTCCTGAGTGCTGTCAAGTGGGG - Intergenic
913968817 1:143398407-143398429 GTCCTGCGTGCCCTCCTCTCTGG + Intergenic
914063196 1:144224006-144224028 GTCCTGCGTGCCCTCCTCTCTGG + Intergenic
914115954 1:144742348-144742370 GTCCTGCGTGCCCTCCTCTCTGG - Intergenic
916203109 1:162290129-162290151 GTCCTGGGTAATCTCCAGTGTGG + Intronic
919088846 1:192953655-192953677 CTCCTGAGTGGCCTCCTCTGAGG - Intergenic
920740197 1:208574668-208574690 GTTTTCAGTGCCCACCAGTGTGG - Intergenic
920964988 1:210694096-210694118 GTCCTGAGGGCTGCCCAGTGAGG - Intronic
921954434 1:220967512-220967534 GTGCTGGGTGCCCTCCCCTGGGG + Intergenic
923044400 1:230344929-230344951 GTCCTGAGTGGCATCCTGAGTGG - Intronic
923388471 1:233489648-233489670 GTGCTGAGTCCCCTTCAGAGTGG - Intergenic
924625557 1:245694410-245694432 CTCCTGAGAGCCCTCCAGCATGG - Intronic
924889172 1:248255220-248255242 GTCCTGAGTGACCTACAAAGAGG + Intergenic
1066930452 10:41751699-41751721 GTCCTGAGTGACCTACAAAGAGG + Intergenic
1069708459 10:70474092-70474114 GTCCTGGGTGCTCTTCAGTCAGG + Intergenic
1071459550 10:85879124-85879146 GTCCTGAGTGACCTACAAAGAGG + Intronic
1072228237 10:93389779-93389801 GCCCTTAGTGCCCTTCATTGAGG - Intronic
1072333922 10:94380511-94380533 GTCCTGGGTTCCCTTCACTGTGG - Intergenic
1072853992 10:98927243-98927265 GTCCTGAGTGACCTACAAAGAGG - Intronic
1073302818 10:102481291-102481313 GGCCACAGTGCCCTCCAGAGAGG - Intronic
1075045026 10:119139908-119139930 AGCCTGAGTGCCCAGCAGTGTGG + Intergenic
1075411519 10:122231969-122231991 GCCCTGAGGGCCCCGCAGTGAGG + Intronic
1076156106 10:128206966-128206988 GGCTTGAGTCCTCTCCAGTGAGG + Intergenic
1076170842 10:128318637-128318659 GTCATGTGTGCCCTCGAGTCCGG - Intergenic
1077172926 11:1176411-1176433 GTCCTGTGGTCCCTCCACTGTGG + Intronic
1079137812 11:17786157-17786179 GGCCTGAGTGCTATCCGGTGTGG + Intergenic
1081963244 11:47153678-47153700 TTCCTGAGTGCCCTACTGCGTGG - Intronic
1085012751 11:73152760-73152782 GTCCTGTAGGCCCTCCAGCGAGG - Intergenic
1085387084 11:76163603-76163625 GTCCAGAGTGCCCTCCGCTCTGG - Intergenic
1085879925 11:80454558-80454580 CTCCTCTGTCCCCTCCAGTGAGG + Intergenic
1087038200 11:93774251-93774273 GGCCTGGTTGCCCACCAGTGGGG - Intronic
1087832127 11:102830690-102830712 GTTCTGAGTGTCCTCCTGTTTGG - Intergenic
1089538152 11:119173342-119173364 GTCTTGTGTGCCCACCATTGTGG + Intronic
1090231804 11:125112195-125112217 GTCCTCAGTTCCCTCCAGGAGGG - Intergenic
1091109764 11:132954995-132955017 TTCATCAGTGCCCTCCACTGTGG - Intronic
1092262620 12:6960583-6960605 TTCCTGAGTGCCCACACGTGTGG + Intronic
1093874269 12:24330467-24330489 GTCCTGACTGTACTCCAGTATGG - Intergenic
1097000762 12:55874546-55874568 GTACTGAGTTCCCTTCACTGTGG + Intergenic
1097233958 12:57527513-57527535 GTCCTGAGTGCCCCCCAACCTGG + Exonic
1101522735 12:105499718-105499740 GACCTGAATACCTTCCAGTGAGG + Intergenic
1103726704 12:123000798-123000820 GTTCAGGGTGGCCTCCAGTGTGG - Exonic
1103917499 12:124383654-124383676 GTCCTTAGTGCCTGCCAGAGGGG - Intronic
1103937645 12:124484993-124485015 GACTTGAGGGCCCTCCAGGGAGG - Intronic
1106440777 13:29766791-29766813 TTGCTGAGTGTCTTCCAGTGTGG + Exonic
1108444424 13:50493097-50493119 GTGGTGAGTGCCCTCCTTTGGGG + Intronic
1109548104 13:63855611-63855633 GACCTGAGAGCACTCCATTGTGG - Intergenic
1115711233 14:36053563-36053585 GGCCTGAGTGTCAGCCAGTGGGG + Intergenic
1117618716 14:57561868-57561890 GTGCTGATTGCCCTCCATGGTGG - Intergenic
1119968785 14:78946373-78946395 GGCCTGAGTGCCCACCAGCAGGG + Intronic
1121273153 14:92651274-92651296 GTCATCAATGCCCTCCAATGTGG + Intronic
1121665186 14:95666736-95666758 GTCCTGTGTGCAATGCAGTGTGG + Intergenic
1121715376 14:96070172-96070194 AACCTGAGTGCCCTCCACAGCGG - Intronic
1122604679 14:102940197-102940219 GGCCTCGGTGCCCTCCTGTGCGG - Intronic
1122836647 14:104433957-104433979 GTCCTTCCTGCCCTCCAGAGGGG + Intergenic
1122939632 14:104975454-104975476 TCCTGGAGTGCCCTCCAGTGAGG - Intronic
1123194005 14:106599443-106599465 GTCCTGAGTCCCCTGCTGTACGG + Intergenic
1124512757 15:30340657-30340679 GCCCTGAGTGTCTCCCAGTGGGG - Intergenic
1124730158 15:32190093-32190115 GCCCTGAGTGTCTCCCAGTGGGG + Intergenic
1128372279 15:67049132-67049154 GTTCTGTCTTCCCTCCAGTGGGG - Intergenic
1128687412 15:69697002-69697024 TTCCTGAGTGCTCTCCAGCCGGG - Intergenic
1130303718 15:82699323-82699345 GTCCAGAGCCCACTCCAGTGGGG + Intronic
1135270373 16:21064350-21064372 GTCATGAGTGAGCCCCAGTGAGG + Intronic
1135637119 16:24087413-24087435 AACCTGAGTGCCCACCAATGGGG - Intronic
1136243009 16:28956133-28956155 GTCCTGTCTGCACTGCAGTGAGG + Exonic
1136476451 16:30516789-30516811 GTCCTCAGGGCCTTGCAGTGTGG - Intronic
1138194271 16:55040867-55040889 GTCCTAAGTGCCTTCCAAGGAGG - Intergenic
1139670547 16:68490239-68490261 GTCCTGAGGACCCTCCTGGGTGG + Intergenic
1140838709 16:78819227-78819249 GTCTTCAGTGACCCCCAGTGAGG + Intronic
1141651911 16:85397287-85397309 AGCCTGAGTGCCCTGCTGTGTGG - Intergenic
1141749517 16:85948704-85948726 GTCCTCAGTGCCCTCCCAGGAGG - Intergenic
1142226962 16:88882181-88882203 GAGCTCAGTGCCCTCCTGTGTGG - Intronic
1142257051 16:89019057-89019079 TGCCTGAGTTCCCTGCAGTGGGG - Intergenic
1142342909 16:89535829-89535851 GTGCTGTGTGGCCTTCAGTGTGG + Intronic
1142342944 16:89536046-89536068 GTGCTGTGTGGCCTTCAGTGTGG + Intronic
1142342949 16:89536077-89536099 GTGCTGTGTGGCCTTCAGTGTGG + Intronic
1142342954 16:89536108-89536130 GTGCTGTGTGGCCTTCAGTGTGG + Intronic
1142342959 16:89536139-89536161 GTGCTGTGTGGCCTTCAGTGTGG + Intronic
1142342964 16:89536170-89536192 GTGCTGTGTGGCCTTCAGTGTGG + Intronic
1142342969 16:89536201-89536223 GTGCTGTGTGGCCTTCAGTGTGG + Intronic
1142342974 16:89536232-89536254 GTGCTGTGTGGCCTTCAGTGTGG + Intronic
1142342979 16:89536261-89536283 GTGCTGTGTGGCCTTCAGTGTGG + Intronic
1142342984 16:89536292-89536314 GTGCTGTGTGGCCTTCAGTGTGG + Intronic
1142342989 16:89536323-89536345 GTGCTGTGTGGCCTTCAGTGTGG + Intronic
1144036617 17:11371561-11371583 ATCCTCACTGCCCTCCTGTGAGG + Intronic
1145296938 17:21599629-21599651 TTCCTGAGTGGCCTCCTTTGAGG + Intergenic
1145367023 17:22273273-22273295 TTCCTGAGTGGCCTCCTTTGAGG - Intergenic
1146668022 17:34717581-34717603 GTCCTGAGTGGCCTCCGGTCTGG - Intergenic
1147746986 17:42700820-42700842 TACGTGTGTGCCCTCCAGTGTGG + Exonic
1148605163 17:48923576-48923598 GAGCTGAGTGCACTCCAGTCTGG + Intronic
1148717974 17:49729354-49729376 GTAGTGAGTGCCCACCAGTGAGG + Intronic
1151340218 17:73466283-73466305 TCCCTGAGTGCCGTCCAGTCTGG + Intronic
1152458318 17:80428487-80428509 GTCCTGAGTGGGCTTCTGTGGGG + Intronic
1152569112 17:81113679-81113701 GTCCTCAGAGCCACCCAGTGTGG + Intronic
1152660044 17:81537830-81537852 GTGCTGAGTGCCAGCCACTGCGG - Intergenic
1152785449 17:82245662-82245684 GTCCTGGGTGCCCACCCGTGAGG - Intronic
1153719777 18:7889989-7890011 GTCCTGTCTGCCCTTCTGTGGGG + Intronic
1154489492 18:14908808-14908830 CTCCTGAGGGCCCTCCCCTGTGG + Intergenic
1155046934 18:22110813-22110835 GCCCTGAGTTCCCTCCACAGGGG + Intergenic
1156420943 18:36952262-36952284 TTCCTAACTTCCCTCCAGTGTGG + Intronic
1158864695 18:61627007-61627029 ATCATGAGTGCCCTGCACTGTGG - Intergenic
1160893845 19:1393689-1393711 GTCCTGCGTGCCCTTCTGTAAGG - Intronic
1163132189 19:15281380-15281402 TGCCTGTGTCCCCTCCAGTGGGG - Intronic
1163655095 19:18541307-18541329 GTCCTGAGTGCACGCCAGCCTGG - Intronic
1165460650 19:35942353-35942375 GTGCTGAGTGCTCTCCAGCTTGG - Intronic
1166429186 19:42709534-42709556 GTAGTGAGTGCACTCCAGTCTGG + Intronic
1167001007 19:46745956-46745978 GTCCTGAGGGCACTCCGGGGTGG - Intronic
1167044376 19:47041143-47041165 GCCCTGAGTGCCCTGCAGGAGGG - Intronic
1168095173 19:54110290-54110312 GTCCTGAGTGCCCTCCAGTGGGG + Intronic
1202702606 1_KI270712v1_random:175877-175899 GTCCTGCGTGCCCTCCTCTCTGG + Intergenic
1202715082 1_KI270714v1_random:37913-37935 TTCCTGAGTTCCCAGCAGTGAGG - Intergenic
925489574 2:4376791-4376813 GTCCTAAGTTCCCTTCACTGTGG + Intergenic
926156761 2:10459661-10459683 GTCCTGAGTGCAGTCTAGTGGGG - Intergenic
926595620 2:14786960-14786982 GTCCTGAGTGACCTACAAAGAGG - Intergenic
927154063 2:20211814-20211836 CGCCTCAGTGCCCTGCAGTGTGG + Intronic
929112529 2:38417361-38417383 GTCCTGAGTCCCCAACAATGAGG + Intergenic
932406240 2:71514026-71514048 ATCCTCAGGGCCCTCCTGTGGGG + Intronic
932979898 2:76651634-76651656 GTCCTGAGTGACCTACAAAGAGG - Intergenic
934173516 2:89559330-89559352 GTCCTGCGTGCCCTCCTCTCTGG + Intergenic
934283830 2:91633683-91633705 GTCCTGCGTGCCCTCCTCTCTGG + Intergenic
935874159 2:107488247-107488269 GTCATCAGTGGGCTCCAGTGAGG - Intergenic
935892107 2:107689675-107689697 GACCTCAGTGGCCTGCAGTGTGG - Intergenic
937062172 2:118988848-118988870 GTCCTGTGTCCCCTCCAGGTGGG - Intronic
937356954 2:121203791-121203813 TTGCTCAGTGCCCTGCAGTGAGG - Intergenic
939574661 2:143881631-143881653 GTCCAGAATGCCATCCAATGTGG - Intergenic
941699789 2:168592345-168592367 GTCCTGAGCTCCAGCCAGTGGGG - Intronic
946721683 2:222615521-222615543 GACCAGTGTGGCCTCCAGTGTGG - Intronic
947118787 2:226797091-226797113 GTCCTCAGTGGCTTCCATTGAGG - Exonic
948545874 2:238728280-238728302 CTCCTAGGTGCCCTCCAGGGAGG - Intergenic
948586724 2:239024434-239024456 GGCCTCAGTGCCCTTCAGTGTGG - Intergenic
948720591 2:239897772-239897794 GGGCTGAGTGACCTCCAGGGCGG - Intronic
948870782 2:240796877-240796899 GACCTGAGTGCCCTCCCCTCGGG + Intronic
1170896580 20:20420331-20420353 GTCCTGAGTGTCCTCTAGTTTGG + Intronic
1172639479 20:36432181-36432203 GCCCGCTGTGCCCTCCAGTGAGG - Exonic
1172738302 20:37145695-37145717 GCCCTGAATACCTTCCAGTGGGG - Intronic
1172965575 20:38831955-38831977 TTCCAGAGTTCCCTCCATTGTGG + Intronic
1173257875 20:41407738-41407760 CTGCTGAGTGCCCACTAGTGTGG - Intronic
1176025437 20:62983086-62983108 GTCCTGTGTGCCCGCCACGGAGG - Intergenic
1176131177 20:63497471-63497493 GGCCTGAGTGCCCCACAGCGGGG + Intronic
1177247811 21:18552628-18552650 TGCCTGAGTGCCTTCAAGTGGGG - Intergenic
1179485483 21:41707665-41707687 TTCCTGAGTTCTCTTCAGTGAGG + Intergenic
1180671055 22:17553388-17553410 GTGCTGTGTGCCCACCAGTTAGG - Exonic
1180718126 22:17886113-17886135 GTCCTGAGTGCACTTCTGTGAGG - Intronic
1180845545 22:18979300-18979322 GCCCTGAGTGACCTCCAGCTGGG + Intergenic
1181646039 22:24232286-24232308 GTCCTCAGGACCCTACAGTGGGG + Intronic
1184911823 22:47540311-47540333 GTCATGGGTGGCCTCCCGTGAGG - Intergenic
950009422 3:9712399-9712421 GTCTTGAGTGCCTTCTGGTGAGG - Intronic
950089831 3:10287747-10287769 GTCCTCAGTGCCTCCCTGTGGGG + Intronic
950109594 3:10410544-10410566 GCCGTGAGTGCCCCCCAGCGTGG + Intronic
952861205 3:37814114-37814136 GTCCTGAGTACCCAGCTGTGTGG + Intronic
954532620 3:51333890-51333912 GCCATGATTGCCCTCCAGTCTGG - Intronic
959099066 3:101989926-101989948 ATCCTGAGTGGCCTACAGAGAGG + Intergenic
959105773 3:102063175-102063197 CTTCTGAGTCCCCTCCAATGAGG - Intergenic
959293155 3:104500281-104500303 GTCTTGAGGGCCCTTCAATGAGG + Intergenic
960971188 3:123141328-123141350 GCCCTGGGTGGCCTCCAGGGAGG - Intronic
961441639 3:126957085-126957107 CTCATGGGGGCCCTCCAGTGGGG + Intronic
962312860 3:134338322-134338344 GTCCTGAGTCCCCTCACCTGTGG + Intergenic
965681794 3:171259437-171259459 GTCCTGACTGGACTCCTGTGAGG - Intronic
968384566 4:124782-124804 GTCCTCAGTCCCCTCCGGTGAGG + Exonic
968393564 4:212907-212929 GTCCTCAGTCCCCTCCGGTGAGG + Intergenic
968405780 4:338102-338124 GGCCTCAGTACCCTCCGGTGAGG + Intronic
968419735 4:473840-473862 GTCCTCAGTCCCCTCCGGTGAGG - Intronic
968466058 4:751903-751925 AGGCTGAGTGCCCACCAGTGGGG - Intronic
968581372 4:1396933-1396955 CTCCCGACTGCCCTGCAGTGTGG - Intergenic
969704034 4:8782465-8782487 GGCCTGAGTGCCCAGCAGAGTGG + Intergenic
971100620 4:23462752-23462774 GTCCTGAGAGCATTCCTGTGAGG + Intergenic
973999835 4:56500709-56500731 GTTCTAAGTGCCCTCAATTGTGG - Intronic
976024724 4:80673653-80673675 GTCCTGAGTGACCTACAAAGAGG - Intronic
978384831 4:108168575-108168597 CTCCGCAGTGCCCTCCACTGCGG - Intronic
980850896 4:138380119-138380141 GTCCTGAGTTGCCTGAAGTGGGG - Intergenic
992771306 5:80050911-80050933 TTCCTGAGTGCTTTCCAGGGTGG + Intronic
995526926 5:113057608-113057630 GTCCTCAGTGCCCTCTGCTGTGG - Intronic
996561283 5:124832305-124832327 GTCCTCACTGTACTCCAGTGTGG + Intergenic
1000908530 5:166993296-166993318 GTCCTGTGTGCCCTCCCGCGAGG + Intergenic
1002254674 5:177950447-177950469 GTCCTGAGGACCCTCAGGTGTGG + Intergenic
1002500557 5:179644813-179644835 GTCCTCAGTGCCTCCCAGAGAGG - Exonic
1006003648 6:30986322-30986344 GTCCAGTGTGACCTCCAGTGGGG + Exonic
1006003658 6:30986367-30986389 GTCCAGCGTGACCTCCAATGGGG + Exonic
1006272891 6:32977855-32977877 GTCTTCAGAGTCCTCCAGTGAGG + Exonic
1007164971 6:39822803-39822825 GTCCTGAGTGCCCTCTACAATGG - Intronic
1007252593 6:40506014-40506036 GCTCTGAGGGCCCTCCAGTGAGG + Intronic
1011028204 6:82892663-82892685 GTCCTGTGTGGAATCCAGTGAGG - Exonic
1012552179 6:100473655-100473677 GTCCTGTGTCCCATCCAGAGGGG + Intergenic
1018043891 6:159949406-159949428 GTCCTGGGTTCCCTTCACTGTGG - Intergenic
1018709303 6:166486362-166486384 GTCCTGAGTGCTCTCCATCCTGG + Intronic
1019290534 7:248066-248088 GTGCTGTGTGCCCATCAGTGAGG + Intronic
1019539901 7:1546829-1546851 CTCCTGAGAGCCCACCTGTGAGG - Exonic
1020005719 7:4782989-4783011 GTCCTGCGGGGCCTCCAGTGTGG - Intronic
1021846951 7:24772198-24772220 GTGCTGAGTGCCTTCCATAGGGG + Intergenic
1023865171 7:44235016-44235038 GTCCTGAGTTCCCATCAGGGAGG - Intronic
1024454969 7:49594978-49595000 GTTCTGAGTAGCCTTCAGTGTGG - Intergenic
1024689714 7:51786162-51786184 ATCCTGAGTGCCCTCCCATCTGG + Intergenic
1026539583 7:71268424-71268446 TTCCTGAGTCCCATCCACTGGGG + Intronic
1033060204 7:138098905-138098927 GTCCTGAGTTTCCACCTGTGCGG - Intronic
1033603371 7:142906801-142906823 GGGCTGAGTGCCCAGCAGTGAGG - Intergenic
1041097426 8:54363519-54363541 GTCCTCAGTGCCGTTCACTGGGG - Intergenic
1041159020 8:55018404-55018426 GACCTCATTACCCTCCAGTGGGG - Intergenic
1041459663 8:58097986-58098008 GTCCTGACTGTCCCCCAGTCAGG + Intronic
1042584049 8:70315841-70315863 GCCCTGAGAGCCTTCCAGAGAGG + Intronic
1045180276 8:99773515-99773537 GTCCTGAGTGACCTACAGAGGGG - Intronic
1045740577 8:105354051-105354073 ATCATGAGTGCTCTCCACTGAGG - Intronic
1049193293 8:141300990-141301012 ATCCTGAGGGGCCTCCGGTGTGG + Intronic
1053165684 9:35842180-35842202 GACCTCAGTTCCCTCCAGTGTGG + Intronic
1053379428 9:37636484-37636506 GTCCTGAGTGTCCTCCCTTAGGG + Intronic
1053614895 9:39754664-39754686 GTTCACTGTGCCCTCCAGTGTGG - Intergenic
1053873073 9:42513937-42513959 GTTCACTGTGCCCTCCAGTGTGG - Intergenic
1053899680 9:42781983-42782005 GTTCACTGTGCCCTCCAGTGCGG + Intergenic
1054238622 9:62587726-62587748 GTTCACTGTGCCCTCCAGTGTGG + Intergenic
1054261966 9:62875610-62875632 GTTCACTGTGCCCTCCAGTGTGG - Intergenic
1054269257 9:62952815-62952837 GTTCACTGTGCCCTCCAGTGTGG + Intergenic
1054552753 9:66622248-66622270 GTTCACTGTGCCCTCCAGTGTGG + Intergenic
1055610815 9:78022100-78022122 ACTCTGAGTGCCCTGCAGTGGGG - Intronic
1058968438 9:110058374-110058396 GTACTGAGTACCCACCATTGAGG + Intronic
1061354936 9:130097474-130097496 GGCCAGATTGCCTTCCAGTGTGG + Intronic
1061948302 9:133920926-133920948 GCCCTGAGTGCCCTCCGTGGGGG + Intronic
1185952499 X:4452066-4452088 TTCCTGAGCCCCATCCAGTGAGG - Intergenic
1189039965 X:37531925-37531947 GCCCTAAGTGCCCTCAGGTGAGG + Intronic
1191118044 X:56871476-56871498 GTCCTGAGTGACCTACAAAGAGG + Intergenic
1194528766 X:95016278-95016300 GTTCTGGGTGTCCTTCAGTGAGG - Intergenic
1195223548 X:102769214-102769236 GTTGTGAGTGCCCAGCAGTGTGG + Intergenic
1196146951 X:112328511-112328533 GTCCTGAGTGACCTACAAAGAGG + Intergenic
1198936764 X:141907389-141907411 GTCCTCAGAGCCCTCCTGAGGGG + Exonic
1200318580 X:155161059-155161081 GTCCTGAGTGACCTACAAAGAGG - Intergenic
1200734640 Y:6781532-6781554 GTACCGAGTGTCCTCCTGTGGGG + Intergenic