ID: 1168095174

View in Genome Browser
Species Human (GRCh38)
Location 19:54110291-54110313
Sequence TCCTGAGTGCCCTCCAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 194}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168095165_1168095174 3 Left 1168095165 19:54110265-54110287 CCGGCTCCCCTCTCACCATGCCA 0: 1
1: 0
2: 3
3: 58
4: 622
Right 1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1168095168_1168095174 -5 Left 1168095168 19:54110273-54110295 CCTCTCACCATGCCACAGTCCTG 0: 1
1: 0
2: 1
3: 37
4: 429
Right 1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1168095162_1168095174 11 Left 1168095162 19:54110257-54110279 CCATCCCTCCGGCTCCCCTCTCA 0: 1
1: 1
2: 2
3: 84
4: 860
Right 1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1168095157_1168095174 23 Left 1168095157 19:54110245-54110267 CCTTCCACCTTCCCATCCCTCCG 0: 1
1: 0
2: 13
3: 245
4: 2264
Right 1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1168095163_1168095174 7 Left 1168095163 19:54110261-54110283 CCCTCCGGCTCCCCTCTCACCAT 0: 1
1: 0
2: 0
3: 36
4: 332
Right 1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1168095164_1168095174 6 Left 1168095164 19:54110262-54110284 CCTCCGGCTCCCCTCTCACCATG 0: 1
1: 1
2: 2
3: 26
4: 316
Right 1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1168095160_1168095174 16 Left 1168095160 19:54110252-54110274 CCTTCCCATCCCTCCGGCTCCCC 0: 1
1: 0
2: 4
3: 109
4: 1492
Right 1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1168095161_1168095174 12 Left 1168095161 19:54110256-54110278 CCCATCCCTCCGGCTCCCCTCTC 0: 1
1: 0
2: 3
3: 58
4: 762
Right 1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1168095166_1168095174 -3 Left 1168095166 19:54110271-54110293 CCCCTCTCACCATGCCACAGTCC 0: 1
1: 0
2: 1
3: 39
4: 497
Right 1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1168095167_1168095174 -4 Left 1168095167 19:54110272-54110294 CCCTCTCACCATGCCACAGTCCT 0: 1
1: 0
2: 3
3: 35
4: 579
Right 1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1168095159_1168095174 19 Left 1168095159 19:54110249-54110271 CCACCTTCCCATCCCTCCGGCTC 0: 1
1: 0
2: 1
3: 75
4: 881
Right 1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168095174 Original CRISPR TCCTGAGTGCCCTCCAGTGG GGG Intronic
900226616 1:1536136-1536158 TCCTGAGCCCCCTCCGGGGGAGG - Intronic
900598440 1:3493042-3493064 TCCTGTTTGCCCTCCTGGGGCGG - Intronic
900824379 1:4914302-4914324 ACCTGAGTGTCCTCCAGCAGGGG - Intergenic
900987337 1:6080765-6080787 CCATGGGTGCCCCCCAGTGGTGG + Intronic
902189621 1:14753125-14753147 CCCTCAGTGCCCTCCAATGATGG - Intronic
904036356 1:27561205-27561227 GCCCTAGAGCCCTCCAGTGGGGG + Intronic
904474309 1:30755056-30755078 TCCTCAGTTGACTCCAGTGGGGG - Intronic
905013469 1:34762089-34762111 TCCTGGGTGGCCTCATGTGGGGG - Exonic
905357277 1:37393603-37393625 TCCTGACTGCCCCAGAGTGGTGG - Intergenic
905887482 1:41499262-41499284 ACATGAGTGCCATGCAGTGGAGG + Intergenic
906922643 1:50081087-50081109 CCCTGACTGCCCTCTTGTGGAGG + Intronic
911479469 1:98419714-98419736 TCCTGTCTCCCCTCAAGTGGTGG + Intergenic
913053759 1:115139067-115139089 ACCAGAGTGCCCTCTAGCGGGGG - Intergenic
913497323 1:119440257-119440279 TCCTGAGTGCTGTCAAGTGGGGG - Intergenic
913505003 1:119508777-119508799 CCCTGAGTGCTGTCAAGTGGGGG - Intronic
915287533 1:154862490-154862512 TCCTGCTGGCCCTCCAGGGGTGG + Intronic
916557675 1:165907475-165907497 TCCTTAGAGCCCTCCTGTGAAGG + Intronic
918494592 1:185120115-185120137 TTCTGACTGTCCTCCAGTGTAGG + Exonic
920570854 1:207016281-207016303 TCCTAAGAGCCCTCAAGTGTCGG + Intronic
921514408 1:216072222-216072244 TGCTGAATGCCTTCCTGTGGTGG + Intronic
922571708 1:226638258-226638280 TCCTGAGTCCCTTGCAGGGGAGG - Intronic
922966604 1:229696093-229696115 GCCTTAGTGCCCTCCCCTGGAGG + Intergenic
922988784 1:229887168-229887190 TCCTGTGTGCCCCCCAGTACTGG + Intergenic
1069079370 10:64071298-64071320 ACCTAGGTGCCCACCAGTGGTGG - Intergenic
1069789182 10:71008774-71008796 ACCTGAGGGCCCACCAGTGTTGG + Intergenic
1071416171 10:85444111-85444133 TCCTGAGTGGCCTCTACTGATGG + Intergenic
1071561640 10:86650352-86650374 TCATGAGTGCCCTGCTTTGGTGG + Intergenic
1072973748 10:100039750-100039772 TCCCGAATGGCCTCCAGGGGAGG + Intergenic
1074729546 10:116354786-116354808 CCCTGAGGGCCTTCCAGTAGGGG + Intronic
1075077642 10:119361629-119361651 TGCTGGGTGCCCGGCAGTGGGGG + Intronic
1075802754 10:125162491-125162513 GCCTGAGCGGCCTGCAGTGGAGG + Intergenic
1076350300 10:129810871-129810893 CCCTGAATGCCCTCCCGTGCTGG - Intergenic
1077829676 11:5852770-5852792 ACCTAAGTGCCCATCAGTGGTGG - Intronic
1079496847 11:21053617-21053639 TCCTGAGTCCCATACAGTGAAGG + Intronic
1081615128 11:44586263-44586285 TCCTAAATGCCCTAGAGTGGTGG - Intronic
1081676438 11:44972683-44972705 TCCAGAATGCCCTCCTGTAGTGG + Intergenic
1083328805 11:61887331-61887353 TTCTGAGTGGCCTCCCTTGGGGG + Intronic
1083842198 11:65310868-65310890 TGCTGAGAGTCCTCCATTGGGGG - Intergenic
1084603008 11:70157527-70157549 TCCAAAGTGACCCCCAGTGGGGG + Intronic
1085303733 11:75473552-75473574 TGCTGAGGGCCCTCAGGTGGAGG - Intronic
1085906351 11:80769010-80769032 ACCTAAGTGCCCATCAGTGGTGG + Intergenic
1086395253 11:86409028-86409050 TCCTTAGATCCCTCTAGTGGTGG + Intronic
1087038199 11:93774250-93774272 GCCTGGTTGCCCACCAGTGGGGG - Intronic
1089174742 11:116540296-116540318 TCCTGTGTGTCCTCCAGTGTTGG - Intergenic
1089289473 11:117428919-117428941 TCTTTATTGCCCCCCAGTGGAGG - Intronic
1089884927 11:121811018-121811040 TCCTGAATGCCCATCAGTGGTGG - Intergenic
1092262621 12:6960584-6960606 TCCTGAGTGCCCACACGTGTGGG + Intronic
1096464715 12:51841965-51841987 TGCTGAGTCCCCATCAGTGGAGG + Intergenic
1100826530 12:98479784-98479806 TCCAGGGAGCGCTCCAGTGGAGG + Intergenic
1106283961 13:28302862-28302884 TCCTGCGTGCCCTGAGGTGGCGG + Exonic
1106928311 13:34635989-34636011 CTCTGAGTTCCCTCAAGTGGAGG - Intergenic
1107467594 13:40664969-40664991 TCCGGAGTGGCCTCGAGTGCCGG - Intronic
1108233461 13:48375109-48375131 ACCTAGGTGCCCTTCAGTGGTGG - Intronic
1109269938 13:60244115-60244137 CCCTGAGTCCCCTCCATTTGCGG - Intergenic
1109996325 13:70132214-70132236 ACCTAAGTGTCCTTCAGTGGGGG + Intergenic
1111550191 13:89799120-89799142 ACCTGGGTGCCCATCAGTGGTGG - Intergenic
1112162502 13:96883710-96883732 TCCTCATTGCCCTCAAATGGGGG + Intergenic
1113683434 13:112261139-112261161 GCCAGAGTGCTCTGCAGTGGAGG - Intergenic
1116403640 14:44541461-44541483 ACCTAGGTGCCCTTCAGTGGTGG + Intergenic
1118325758 14:64779298-64779320 TCCTGAGTGCTCACCATGGGCGG + Intronic
1119391535 14:74294426-74294448 TTCTTGGTGCCCTCAAGTGGTGG + Intronic
1121220759 14:92283821-92283843 TCCTGAGGGGCCGCCAGGGGAGG - Intergenic
1122370946 14:101228678-101228700 TCCTGACTTCCCTCCAGGAGAGG + Intergenic
1122774356 14:104110699-104110721 CCCTAAGGGCCCTCCAGAGGAGG + Intronic
1122836648 14:104433958-104433980 TCCTTCCTGCCCTCCAGAGGGGG + Intergenic
1123218141 14:106831387-106831409 TCCTGAGTGCCCCCTGGTGGTGG + Intergenic
1125199090 15:37083809-37083831 ACCCCAGGGCCCTCCAGTGGGGG - Exonic
1128114552 15:65097079-65097101 TCCTGACTGCCCACCAGGGAAGG + Intronic
1128426004 15:67542904-67542926 GACTGAGTCCCCTCCAGTCGAGG + Exonic
1128687411 15:69697001-69697023 TCCTGAGTGCTCTCCAGCCGGGG - Intergenic
1130303719 15:82699324-82699346 TCCAGAGCCCACTCCAGTGGGGG + Intronic
1131389416 15:92034751-92034773 TCCCATGTCCCCTCCAGTGGTGG + Intronic
1132337192 15:101055572-101055594 TCCTGAGTGCCCTGCAAGGCTGG - Intronic
1133282615 16:4675865-4675887 TTCTGAGTGTCTTCCAGTAGAGG + Intronic
1133327000 16:4947904-4947926 ACCTAAGTGCCCATCAGTGGGGG + Intronic
1134109220 16:11504157-11504179 TCCTGGTTTCCCTCCACTGGAGG + Intronic
1135046237 16:19158281-19158303 ACCTAAGTGCCCATCAGTGGTGG + Intronic
1135637118 16:24087412-24087434 ACCTGAGTGCCCACCAATGGGGG - Intronic
1140608962 16:76575295-76575317 TCCTTAGTGACCTCCAGTTGTGG + Intronic
1140644635 16:77016100-77016122 TCCTGAGTGCACTCCAGACTTGG + Intergenic
1140830999 16:78750888-78750910 TCCTAAGTGCCCATCAATGGTGG - Intronic
1142594098 17:1021188-1021210 TCCTGAGTGGCGTCCACTGAAGG - Intronic
1145296939 17:21599630-21599652 TCCTGAGTGGCCTCCTTTGAGGG + Intergenic
1145367022 17:22273272-22273294 TCCTGAGTGGCCTCCTTTGAGGG - Intergenic
1145911804 17:28547458-28547480 TCCTGAAGCCCCTGCAGTGGCGG - Intronic
1148717975 17:49729355-49729377 TAGTGAGTGCCCACCAGTGAGGG + Intronic
1149707779 17:58711148-58711170 TCTTGAGTGCCCCCTACTGGAGG - Intronic
1150697719 17:67420211-67420233 TCCTGAGAACCCTGCACTGGAGG - Intronic
1151340220 17:73466284-73466306 CCCTGAGTGCCGTCCAGTCTGGG + Intronic
1152036291 17:77875063-77875085 CCCTCAGTGCCCACAAGTGGGGG - Intergenic
1152458319 17:80428488-80428510 TCCTGAGTGGGCTTCTGTGGGGG + Intronic
1152785228 17:82244472-82244494 GCCTCAGCTCCCTCCAGTGGTGG - Exonic
1152801102 17:82331038-82331060 CACTGAGTGCCCTCCAATGTTGG + Intronic
1153719778 18:7889990-7890012 TCCTGTCTGCCCTTCTGTGGGGG + Intronic
1155003060 18:21704886-21704908 TCCTGAGTGGCTGGCAGTGGGGG - Intergenic
1158864694 18:61627006-61627028 TCATGAGTGCCCTGCACTGTGGG - Intergenic
1160124548 18:76158717-76158739 ACCTGCGTGCCTGCCAGTGGGGG - Intergenic
1161026797 19:2040659-2040681 CCCTGTGTGGCCTCCAGTCGAGG - Intronic
1162124003 19:8489725-8489747 TCCTGAGAGCGCTTCACTGGGGG - Intergenic
1164789768 19:30965982-30966004 TCATGAGTGCCCTACAGTGCAGG - Intergenic
1166003079 19:39889780-39889802 TCCTGTGAGCCCTCCAGCTGCGG - Exonic
1166005866 19:39906032-39906054 TCCTGTGAGCCCTCCAGCTGCGG - Exonic
1166810600 19:45512190-45512212 TCCTGAGTTCCCCTCAATGGAGG + Intronic
1167044374 19:47041142-47041164 CCCTGAGTGCCCTGCAGGAGGGG - Intronic
1168095174 19:54110291-54110313 TCCTGAGTGCCCTCCAGTGGGGG + Intronic
1168349005 19:55665301-55665323 TCCTAAGTGCCCTCCATGGACGG + Intronic
1168349022 19:55665403-55665425 TCCTAAGTGCCCTCCATGGACGG + Intronic
1168349031 19:55665454-55665476 TCCTAAGTGCCCTCCATGGACGG + Intronic
1168349040 19:55665505-55665527 TCCTAAGTGCCCTCCATGGACGG + Intronic
926911388 2:17854549-17854571 ACCTAAGTGCCCATCAGTGGTGG - Intergenic
931699689 2:64899519-64899541 TCCTGAGAGCGCTCCAGGGTAGG - Intergenic
932406241 2:71514027-71514049 TCCTCAGGGCCCTCCTGTGGGGG + Intronic
932639760 2:73432590-73432612 TCCTCTGTGCCCTCCCATGGTGG + Intronic
937062171 2:118988847-118988869 TCCTGTGTCCCCTCCAGGTGGGG - Intronic
941716921 2:168773869-168773891 TACTGAGTGCCCCCTAGGGGTGG - Exonic
943536772 2:189162038-189162060 TCAGGTGTGCCCTCCAGGGGAGG + Intronic
946089641 2:217209433-217209455 TCCTGAGATCCTTCCAGTTGAGG + Intergenic
948034469 2:234847063-234847085 ACCTGAGAGCCCTGCAGTAGGGG - Intergenic
948278164 2:236725872-236725894 TCCTTGGGCCCCTCCAGTGGTGG - Intergenic
948827421 2:240579375-240579397 ATATGAGTCCCCTCCAGTGGCGG + Exonic
1170874299 20:20235818-20235840 GCATGAGGGCCCTCCAGTAGAGG + Intronic
1172402491 20:34661610-34661632 ACCTGAATGCCCATCAGTGGTGG - Intronic
1172920726 20:38479716-38479738 TCCTGAGTCCCCTCCCCAGGTGG - Intronic
1173065641 20:39708065-39708087 TCCTGAGCACCCTCCTGTGAAGG + Intergenic
1173257874 20:41407737-41407759 TGCTGAGTGCCCACTAGTGTGGG - Intronic
1174585788 20:51607156-51607178 ACCTCAGTGGCCTCCAGAGGGGG - Intronic
1174961524 20:55162547-55162569 TCCCAAGAGCCCACCAGTGGGGG - Intergenic
1176131178 20:63497472-63497494 GCCTGAGTGCCCCACAGCGGGGG + Intronic
1178047844 21:28715035-28715057 ACCTAGGTGCCCTTCAGTGGTGG - Intergenic
1180098995 21:45575586-45575608 TCACCTGTGCCCTCCAGTGGGGG + Intergenic
1180718125 22:17886112-17886134 TCCTGAGTGCACTTCTGTGAGGG - Intronic
1180845547 22:18979301-18979323 CCCTGAGTGACCTCCAGCTGGGG + Intergenic
1181362227 22:22346612-22346634 TCCTGAGGGCCCTGAAGTGGAGG + Intergenic
1181646040 22:24232287-24232309 TCCTCAGGACCCTACAGTGGGGG + Intronic
1181896836 22:26117181-26117203 ACCTAAGTGCCCACCAGTGGTGG + Intergenic
1183464973 22:37975071-37975093 TTCTAAGTGCCCTCCCATGGAGG - Intronic
1185069994 22:48650954-48650976 TCCTCAGTGCCGTGCTGTGGTGG - Intronic
949570136 3:5284598-5284620 TGCTGAGTGCCTGCCATTGGAGG - Intergenic
949574448 3:5325269-5325291 TCCTGAGTGCACTCCTGTTGTGG + Intergenic
949742659 3:7254013-7254035 TCCTGGGTGACCTCCAGGGTTGG - Intronic
952519062 3:34136978-34137000 ACCTAAGTGCCCATCAGTGGAGG + Intergenic
954445335 3:50543227-50543249 TCCTGAGGGCCCTCTGCTGGGGG - Intergenic
954581853 3:51707239-51707261 TCCTGCGGGCCCTCAAGTTGTGG + Intronic
954934160 3:54311594-54311616 ACCAGTGTGCCCTCCAGAGGAGG + Intronic
956211047 3:66802004-66802026 ACCTGGGTGCCCATCAGTGGTGG + Intergenic
956755159 3:72378497-72378519 TCCACAGTGACCTCCAGTGCAGG - Exonic
960829559 3:121831970-121831992 GCTTGAGTGACCTCCAGTAGAGG - Intronic
962422459 3:135240505-135240527 TCCTGCCAGCCCTTCAGTGGAGG - Intronic
962842061 3:139242975-139242997 TCTTTTGTGCCCTTCAGTGGAGG + Intronic
963075051 3:141338391-141338413 ACCTAAATGCCCACCAGTGGTGG + Intronic
963171033 3:142251511-142251533 TTCTGGGTGCGCTCCTGTGGTGG - Intergenic
964254774 3:154763772-154763794 TCCTAGGTGCCCATCAGTGGTGG - Intergenic
968384567 4:124783-124805 TCCTCAGTCCCCTCCGGTGAGGG + Exonic
968393565 4:212908-212930 TCCTCAGTCCCCTCCGGTGAGGG + Intergenic
968419734 4:473839-473861 TCCTCAGTCCCCTCCGGTGAGGG - Intronic
968466057 4:751902-751924 GGCTGAGTGCCCACCAGTGGGGG - Intronic
968889550 4:3361019-3361041 GCCTGACTGCCCACCAGTGGTGG + Intronic
970006801 4:11418774-11418796 ACCTGAGTGCCATCTTGTGGAGG - Intronic
970656933 4:18241612-18241634 ACCTAAGTGCCCATCAGTGGTGG - Intergenic
977331582 4:95643521-95643543 TCCTCAGTGCCCTCTAGTTCTGG - Intergenic
978771154 4:112457492-112457514 TCCTGAGGCCCATACAGTGGAGG + Intergenic
979490597 4:121322756-121322778 TTCTGAGTGCCTGCCAGTAGAGG - Intergenic
983161040 4:164414539-164414561 ACCTAAGTGCCCATCAGTGGTGG - Intergenic
984967901 4:185156673-185156695 ACCTAGGTGCCCTTCAGTGGTGG + Intergenic
985633916 5:1026837-1026859 TCCCGAGTGCCCTGAGGTGGCGG + Intronic
987095515 5:14545963-14545985 CCCTCAGTGTCCTCCTGTGGTGG - Intergenic
991586172 5:68204095-68204117 CTCTGGGTCCCCTCCAGTGGAGG + Intergenic
992992088 5:82294170-82294192 TCCTAAGTGCCCCCAAATGGTGG + Intronic
993495030 5:88599087-88599109 TGCTGAGTCCCCAACAGTGGTGG - Intergenic
995526313 5:113053238-113053260 ACCATAGTGCCCTCCAGTGAAGG - Intronic
996633192 5:125661853-125661875 ACCTGGGTGCCCATCAGTGGTGG - Intergenic
997379092 5:133422386-133422408 TCCTCAGTGCCCCCCAGTCCAGG - Intronic
1000908531 5:166993297-166993319 TCCTGTGTGCCCTCCCGCGAGGG + Intergenic
1001766455 5:174251485-174251507 TGCTGAGTGCCCTTCCCTGGGGG - Intergenic
1003306647 6:4934985-4935007 TCCTGAGTGTCCCACAGGGGTGG + Intronic
1007252594 6:40506015-40506037 CTCTGAGGGCCCTCCAGTGAGGG + Intronic
1007790112 6:44303936-44303958 TCCTGAAGGCCCTCCAGCAGGGG - Intronic
1012552180 6:100473656-100473678 TCCTGTGTCCCATCCAGAGGGGG + Intergenic
1013290266 6:108713330-108713352 TCCTGAGTGACCTGCAGGGGAGG - Intergenic
1015349820 6:132204510-132204532 GCCTAAGTGCCCATCAGTGGTGG - Intergenic
1017268774 6:152481830-152481852 GCCTTAGTGCCCTAAAGTGGGGG - Intronic
1020811026 7:12850398-12850420 TCTTGAGTCACCTGCAGTGGAGG - Intergenic
1024831653 7:53466436-53466458 TCCTGAATGCCCAACAATGGTGG - Intergenic
1025030473 7:55552669-55552691 ACCTGAGTGCCCCCCATTGTTGG - Intronic
1027879138 7:83810729-83810751 TCCTAGGTGCCCATCAGTGGTGG - Intergenic
1028481422 7:91310474-91310496 TTCTCAGAGCCCTCCAATGGTGG + Intergenic
1031818075 7:126464555-126464577 TCCTGACTTCCTTTCAGTGGAGG + Intronic
1034833207 7:154328008-154328030 TCCTGAGACCCCTCTGGTGGAGG + Intronic
1044009172 8:86970851-86970873 ACCTAGGTGCCCTTCAGTGGTGG - Intronic
1046450260 8:114381180-114381202 ACCTAGGTGCCCTTCAGTGGTGG - Intergenic
1048824609 8:138411815-138411837 TCCTAGGTGCCCATCAGTGGTGG + Intronic
1049193294 8:141300991-141301013 TCCTGAGGGGCCTCCGGTGTGGG + Intronic
1050150632 9:2616359-2616381 TTCTGAATGCCCTCCAGGAGGGG + Intergenic
1050176034 9:2870173-2870195 TCCTCAGTGCCCTCCAATAGTGG - Intergenic
1050994952 9:12205538-12205560 TGCCTAGTGTCCTCCAGTGGTGG - Intergenic
1052661375 9:31436742-31436764 TCCTAAATGCCTTCCAGTGCTGG + Intergenic
1056215711 9:84404274-84404296 TCATCAGCGCCCTCAAGTGGCGG - Intergenic
1057305224 9:93908416-93908438 TCCAGAGGGCCCTGAAGTGGGGG + Intergenic
1061948304 9:133920927-133920949 CCCTGAGTGCCCTCCGTGGGGGG + Intronic
1062573912 9:137197839-137197861 TCCTGAGGTGCTTCCAGTGGGGG - Intronic
1186587979 X:10897322-10897344 ACCTAAGTGCCCATCAGTGGTGG + Intergenic
1186610870 X:11137057-11137079 CCCTGAGTCCCAGCCAGTGGTGG + Intergenic
1188075221 X:25767624-25767646 ACCTAAGTGCCCATCAGTGGTGG - Intergenic
1188599328 X:31941926-31941948 ACCTAGGTGCCCACCAGTGGTGG - Intronic
1189244574 X:39553634-39553656 TAGTGACTGCCTTCCAGTGGAGG + Intergenic
1189587742 X:42477982-42478004 TCCTAAGTGCCCTCCTTTTGAGG + Intergenic
1195871193 X:109488219-109488241 ACCTGAATGCCCACCAATGGGGG + Intergenic
1196151882 X:112383592-112383614 ACCTGGGTGCCCACCAATGGTGG + Intergenic
1198329837 X:135612033-135612055 TCCTGAGACCCCTCAAATGGAGG - Intergenic
1200115753 X:153769060-153769082 TCCTGACTGCCCACCAGGTGAGG + Exonic
1202046070 Y:20738310-20738332 TCCTGGGTGGCCTCCAGAGTTGG - Intergenic