ID: 1168098674

View in Genome Browser
Species Human (GRCh38)
Location 19:54129315-54129337
Sequence GCCCGAGGAGCGGTCGCGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168098674_1168098688 24 Left 1168098674 19:54129315-54129337 CCATCCGCGACCGCTCCTCGGGC 0: 1
1: 0
2: 1
3: 7
4: 69
Right 1168098688 19:54129362-54129384 CCACTCCAGGTACCTCCCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 193
1168098674_1168098689 28 Left 1168098674 19:54129315-54129337 CCATCCGCGACCGCTCCTCGGGC 0: 1
1: 0
2: 1
3: 7
4: 69
Right 1168098689 19:54129366-54129388 TCCAGGTACCTCCCCTGGGCCGG 0: 1
1: 0
2: 2
3: 20
4: 255
1168098674_1168098686 23 Left 1168098674 19:54129315-54129337 CCATCCGCGACCGCTCCTCGGGC 0: 1
1: 0
2: 1
3: 7
4: 69
Right 1168098686 19:54129361-54129383 CCCACTCCAGGTACCTCCCCTGG 0: 1
1: 0
2: 0
3: 26
4: 261
1168098674_1168098682 11 Left 1168098674 19:54129315-54129337 CCATCCGCGACCGCTCCTCGGGC 0: 1
1: 0
2: 1
3: 7
4: 69
Right 1168098682 19:54129349-54129371 CGTGGCCTTCACCCCACTCCAGG 0: 1
1: 0
2: 3
3: 22
4: 175
1168098674_1168098679 -7 Left 1168098674 19:54129315-54129337 CCATCCGCGACCGCTCCTCGGGC 0: 1
1: 0
2: 1
3: 7
4: 69
Right 1168098679 19:54129331-54129353 CTCGGGCACGGCCTCCAGCGTGG 0: 1
1: 0
2: 0
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168098674 Original CRISPR GCCCGAGGAGCGGTCGCGGA TGG (reversed) Exonic
901808155 1:11750600-11750622 GCCCGAGGAGCAGTCTGGCATGG + Exonic
907276933 1:53321874-53321896 GCCCTAGGAGGGGCAGCGGATGG - Intronic
910427526 1:87131940-87131962 GCCCGAGGCGCGGTCGCAGCCGG + Intronic
910449035 1:87328656-87328678 GCCCCGGGAGCGGCGGCGGACGG - Exonic
910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG + Intronic
917962222 1:180154551-180154573 GCCCGCCGAGCGGTCGCTGCGGG - Intergenic
1076858425 10:133128470-133128492 GCCCGAGGAGCAGCGGCGGCTGG + Exonic
1076890785 10:133282237-133282259 GGCCGAGGAGCGGGCCCGGAAGG - Exonic
1077491405 11:2862554-2862576 GCGCGAGGAGCGGGCGCGGCCGG - Intergenic
1086349846 11:85934725-85934747 GCTCGAGGCGCGGACGCGGGCGG - Intergenic
1091550105 12:1530462-1530484 GCCCGAGGCGCGGGCTCGGGAGG - Intronic
1092002729 12:5045018-5045040 GCCCCAGGGGCGGGCGCGGGAGG - Exonic
1112402173 13:99086653-99086675 GCCCGGCGAGTGGTCGCCGAGGG - Intergenic
1113702033 13:112395294-112395316 GCCAGAGGAGCTGTCGATGATGG + Intronic
1117139053 14:52767621-52767643 GCCAGAGGAGTGGTTGGGGAAGG + Intronic
1118992335 14:70808700-70808722 GCCTGGGGGGCGGTCGGGGAAGG - Intronic
1121417172 14:93787724-93787746 GCCCCAGGAGCGGGCGCCGCTGG - Exonic
1124001857 15:25766742-25766764 GCCCGAGGAGCGCTTGCAGGCGG - Intronic
1128075644 15:64823852-64823874 GCCCGAGGAGCGGCGGCTCAGGG - Exonic
1131180170 15:90233975-90233997 GCCCCAGGAGCGGTTGCCGCGGG - Exonic
1132522238 16:397174-397196 GCGCGAGGAGCGGGCGCGGAGGG - Intronic
1133292928 16:4734609-4734631 GCCCGAGGGGCGGACGCGAGCGG + Exonic
1133784300 16:8963179-8963201 GCCCGAGGGCCGGCCGCGGCGGG - Intronic
1134539935 16:15056037-15056059 GCCCGAGGGGCGGGGGCGGCGGG - Exonic
1135491713 16:22915153-22915175 GCCCAGGGTGCGGTTGCGGAAGG - Exonic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1143112621 17:4560713-4560735 GCCCGAGGAGCTCTCGCGACAGG + Exonic
1143541768 17:7573412-7573434 CCCCGAGGAGCGGCCGCGTGAGG + Intronic
1143747274 17:9003595-9003617 GCCCGGGGCGCGGGCGCGGCAGG - Intergenic
1146433712 17:32822789-32822811 GACTGAGGAGCGGTCGCGAGCGG - Intronic
1147971893 17:44222535-44222557 GCCCCAGGAGCGGTGGCTGGAGG - Intergenic
1147994551 17:44353750-44353772 GCGGGAGGAGCGGCCGCTGATGG - Exonic
1148437306 17:47694362-47694384 GCCTGAGGAACGGCGGCGGAGGG - Intronic
1150823829 17:68457478-68457500 GCCCGTGGAGCCGGCGCGGGCGG - Intronic
1152924422 17:83080653-83080675 TCCCGAGGGGCAGTCGCGGTCGG - Intronic
1156452447 18:37274530-37274552 CCCCGAGGAGCGGGCGGGGTGGG - Intronic
1160725547 19:616475-616497 GCCCGCGGGGCGGTCGGCGAGGG - Exonic
1160829224 19:1095186-1095208 GCCCGAGGTGGGGTCGAGCACGG - Intronic
1161153384 19:2720912-2720934 CCCCGGGGAGGGGGCGCGGAGGG + Intronic
1161978241 19:7617841-7617863 GACAGAGGAGCTGTCGCGGCTGG + Exonic
1163502026 19:17681837-17681859 GCCCGAGGAGCGCTCCAAGAGGG - Intronic
1163551200 19:17967218-17967240 GCCGGAGCCGGGGTCGCGGACGG - Intronic
1165879445 19:39032083-39032105 GCCCGAGCAGCGTGCGCGGGGGG + Exonic
1168098674 19:54129315-54129337 GCCCGAGGAGCGGTCGCGGATGG - Exonic
927606569 2:24491510-24491532 GCCCGAGGAGCGGCGGAGGCCGG + Intergenic
927982261 2:27381388-27381410 GCCCGAGGAGCAGAGGCGGCTGG + Exonic
942178200 2:173355004-173355026 ACCCGAGGGGCGGGCGCGGTGGG + Intronic
1181064471 22:20299101-20299123 TCCCGAGGAGAGGGCGCGGCTGG + Intergenic
1181064506 22:20299211-20299233 TCCCGAGGAGCGGGCGCGGCTGG + Intergenic
1181064520 22:20299251-20299273 TCTCGAGGAGCGGGCGCGGCTGG + Intergenic
1182355300 22:29720116-29720138 CACCGAGGAGCGGGCGCGGCGGG + Exonic
1184265290 22:43343103-43343125 GGCCGAGGCGCGGTCCCGGAGGG - Intronic
1184819955 22:46902974-46902996 GCCCGAGGAGGGGCAGCGTATGG + Intronic
1185289199 22:50015450-50015472 GCTGGAGGAGCGGTGGCGGGGGG - Intronic
1203255557 22_KI270733v1_random:135748-135770 GACCGAGGAGAGGTCGCGAGCGG - Intergenic
950710628 3:14810753-14810775 CCCCGCGGGGCGGCCGCGGAGGG + Intergenic
956681466 3:71785323-71785345 GCCCGAGGCGGGGGCGCGGGGGG - Intergenic
961664137 3:128485969-128485991 GCCCGAGGAGAGGACAAGGACGG - Exonic
962129842 3:132660617-132660639 TCCCGAGGAGCGGCGACGGAGGG + Exonic
968457241 4:706000-706022 GCCTGAGGAGCGGGCGCCGAGGG - Intronic
968660085 4:1795241-1795263 GCCGGAGGGGCGGCCGCGGGGGG + Intronic
973551296 4:52038306-52038328 GCGCAGGGTGCGGTCGCGGAGGG - Exonic
985727427 5:1523618-1523640 GGCCGAGGAGGGGCCGGGGAGGG - Intronic
986733226 5:10649939-10649961 GCCCGAGCGGCCGGCGCGGAAGG + Exonic
1002692452 5:181059672-181059694 GCCCGAGAAGGTGTCGTGGAAGG - Exonic
1005470264 6:26156406-26156428 GCCGGAGCAGCGGGCGCGGCAGG - Exonic
1006396157 6:33788863-33788885 GCCCGCGGAGAGGCCGCGGCGGG + Exonic
1007630312 6:43269755-43269777 GCCCGAGGAGCCGCCGCCGCCGG - Intronic
1008629275 6:53348382-53348404 GCCGGGGGAGCGCTCTCGGAGGG - Intronic
1013207590 6:107958464-107958486 GCCGGAGCAGCGGTCGCGGGCGG + Intergenic
1027400349 7:77799415-77799437 GCCGGAGGAGCGGGCTCGGGAGG + Intronic
1033347169 7:140534576-140534598 GCCCGAGGAGCCCTCAAGGAGGG + Intronic
1036638052 8:10564944-10564966 GCCGGTGGGGCGGTGGCGGATGG + Intergenic
1036761063 8:11508847-11508869 GCCAGAGGAGCCGTGGTGGAGGG + Intronic
1049109666 8:140635308-140635330 GCTCGAGGAGCGGCGGCGGCGGG - Intronic
1203471953 Un_GL000220v1:118883-118905 GACCGAGGAGAGGTCGCGAGCGG - Intergenic
1200218575 X:154379589-154379611 GCACGAGGAGGGGGCCCGGAAGG - Intronic
1200787741 Y:7274411-7274433 CCCCGAGGCGCGGTCGCCGGAGG + Intergenic