ID: 1168099724

View in Genome Browser
Species Human (GRCh38)
Location 19:54134567-54134589
Sequence TGGGGTAGTTCAGCCACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168099724_1168099730 27 Left 1168099724 19:54134567-54134589 CCTTGAGTGGCTGAACTACCCCA No data
Right 1168099730 19:54134617-54134639 AATGTTATCCCTGACCCTCTGGG No data
1168099724_1168099729 26 Left 1168099724 19:54134567-54134589 CCTTGAGTGGCTGAACTACCCCA No data
Right 1168099729 19:54134616-54134638 CAATGTTATCCCTGACCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168099724 Original CRISPR TGGGGTAGTTCAGCCACTCA AGG (reversed) Intergenic
No off target data available for this crispr