ID: 1168102192

View in Genome Browser
Species Human (GRCh38)
Location 19:54147253-54147275
Sequence AATGTTAGGCAGGAGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168102185_1168102192 30 Left 1168102185 19:54147200-54147222 CCTTTGACATCTCCCAGGACAGG 0: 1
1: 0
2: 1
3: 21
4: 198
Right 1168102192 19:54147253-54147275 AATGTTAGGCAGGAGCAGCATGG 0: 1
1: 0
2: 0
3: 16
4: 190
1168102188_1168102192 17 Left 1168102188 19:54147213-54147235 CCAGGACAGGAGCACGCTTTCGG 0: 1
1: 0
2: 0
3: 14
4: 73
Right 1168102192 19:54147253-54147275 AATGTTAGGCAGGAGCAGCATGG 0: 1
1: 0
2: 0
3: 16
4: 190
1168102187_1168102192 18 Left 1168102187 19:54147212-54147234 CCCAGGACAGGAGCACGCTTTCG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1168102192 19:54147253-54147275 AATGTTAGGCAGGAGCAGCATGG 0: 1
1: 0
2: 0
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168102192 Original CRISPR AATGTTAGGCAGGAGCAGCA TGG Intronic
900105276 1:978433-978455 AATCTCAGGCAGAAGAAGCACGG - Intronic
903375689 1:22864401-22864423 CATTTTAGGCAGCAGAAGCAGGG + Intronic
903567692 1:24280960-24280982 AATGATATGCAGGAACAACATGG - Intergenic
908041012 1:60113239-60113261 AGTGTTGGGCAAGAGCAGCAGGG + Intergenic
908098530 1:60766235-60766257 AAAGTCAGGCAGAAGAAGCAAGG + Intergenic
908784309 1:67720025-67720047 ACTTGTAGGAAGGAGCAGCAAGG - Intronic
909265090 1:73548361-73548383 AATATTTAACAGGAGCAGCAGGG + Intergenic
910969028 1:92835815-92835837 ATTGTTAAGCATGTGCAGCAAGG + Intronic
915045335 1:153008695-153008717 AATGTCAGGCAGGAGTAAAAAGG + Intergenic
916521595 1:165568348-165568370 AAAGGTAAGCAGGAGCTGCAGGG - Intergenic
917815785 1:178708527-178708549 TATGTGAGGCAGCAGCAGCAAGG + Intergenic
918002800 1:180513323-180513345 CATGTCAGGCAGGAGTTGCATGG + Intergenic
918091232 1:181296979-181297001 GAGGTTAGACAGGAGTAGCAGGG + Intergenic
919284389 1:195536090-195536112 ATTGTTAGGCATGAAGAGCAAGG - Intergenic
1063186917 10:3660099-3660121 AAGATAAGGCAGAAGCAGCAAGG + Intergenic
1063833319 10:9982395-9982417 TATGTTAGGCAAGAACTGCAGGG + Intergenic
1064839391 10:19573487-19573509 AACTTTAGGCAGGAAAAGCAGGG + Intronic
1064970939 10:21066176-21066198 CAAGTTAGGAAGGAGAAGCAGGG - Intronic
1068128906 10:52873071-52873093 ATTGATAGACAGGAGGAGCAGGG + Intergenic
1068378281 10:56213191-56213213 TGTGTGAGGCAGCAGCAGCAGGG + Intergenic
1069640952 10:69955283-69955305 AGGGTTTGGCAGGACCAGCAGGG - Intronic
1069841299 10:71341080-71341102 AATGAGAGGCAGGAGCTGGAAGG - Intronic
1071045334 10:81367338-81367360 AAGGTTAGCTAGGAGCAGCAGGG - Intergenic
1071796199 10:89008808-89008830 AATGGTGGGCAGGAGCTGCATGG - Intronic
1072448439 10:95519571-95519593 AATTTTAAGCAAGAGCAGAAGGG + Intronic
1077370558 11:2179815-2179837 AAAGTCAGGCAGGTGCAGAAGGG - Intergenic
1078357830 11:10646074-10646096 AATGTAAGGTATAAGCAGCATGG - Intronic
1085421833 11:76369366-76369388 AATGTTAAGCAGAAGAAGCCAGG + Intronic
1085541904 11:77278788-77278810 TATGTTAGGCAACAGAAGCAAGG + Intronic
1087063259 11:94003658-94003680 AAGATTACTCAGGAGCAGCACGG + Intergenic
1088908413 11:114171981-114172003 AAAGGGAGACAGGAGCAGCAGGG + Intronic
1089029077 11:115304119-115304141 AATGTTAGACATGTGCAACATGG + Intronic
1090207824 11:124895655-124895677 AAGATTGGGCAGGCGCAGCAGGG + Exonic
1091641955 12:2244117-2244139 AATCTGAGCCAAGAGCAGCAGGG - Intronic
1091654032 12:2331725-2331747 CATTTTGGGCAGGAGCACCACGG - Intronic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1093565330 12:20596343-20596365 GATGTCAGGCAGGATCATCAAGG - Intronic
1097351401 12:58553209-58553231 AAGGGTAGGAAGGAGGAGCAGGG - Intronic
1098038696 12:66333311-66333333 AATGTTACCAAGGAGCAGCATGG + Intronic
1098752231 12:74308988-74309010 GATGATAGGCAGGAGAACCAGGG + Intergenic
1100913807 12:99394715-99394737 AATGAAAGGCAGCACCAGCAAGG - Intronic
1104375179 12:128259654-128259676 AATGCTAGTCAGGACCACCAGGG + Intergenic
1106848208 13:33760551-33760573 AATGTTAGGCAAAAGCAGACAGG + Intergenic
1111721798 13:91955750-91955772 AATTTTAAGCAGCTGCAGCATGG + Intronic
1112530270 13:100194831-100194853 ACTGTGAGGCATGAGCAGGAAGG + Intronic
1116243636 14:42379611-42379633 CATGTTAGCCAGGTGCAGCAGGG - Intergenic
1119187413 14:72652496-72652518 AAATTAAGGCAGGAGAAGCAGGG + Intronic
1120056059 14:79925442-79925464 AGAGTTAAACAGGAGCAGCAAGG - Intergenic
1128215103 15:65929456-65929478 AATGTTTACCAAGAGCAGCACGG + Intronic
1128724994 15:69981932-69981954 AATGTGAGGGAGGCACAGCAGGG - Intergenic
1132366760 15:101263485-101263507 AATGGCAGGCAGGGGCATCATGG + Intergenic
1136562286 16:31047093-31047115 GGTGTTAGGCAGGGGAAGCAGGG - Intergenic
1138580319 16:57936878-57936900 AATTTTAGGCAGGAAGAGAAGGG + Intronic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1144209620 17:13003363-13003385 AAGTTTAGGCAGGTGCAGAAGGG + Intronic
1145830595 17:27913210-27913232 AATGTGAGGCAGCAGTAGGAGGG - Intergenic
1147960177 17:44162502-44162524 GCAGTTAGGCAGGAGCAGCAGGG - Intergenic
1149169937 17:53797123-53797145 AAGATTAGGAAGGAGCACCAGGG + Intergenic
1149654353 17:58302452-58302474 AATGTGAGACAGAAGGAGCAAGG + Intronic
1151207435 17:72518311-72518333 AATGTTTGGCAGGGGCTGGAGGG + Intergenic
1152633067 17:81419400-81419422 AATGTGGGGCAGGGCCAGCAGGG + Intronic
1153141994 18:1983476-1983498 AAACTGAGGCAGGAGCACCAAGG + Intergenic
1153151957 18:2105949-2105971 AATGTTAGACACCAGCAGGAAGG + Intergenic
1154063664 18:11086700-11086722 AAAGTTTGGCTGGAGCAGCAGGG - Intronic
1158210822 18:55047816-55047838 CATGTTAGGCAGCAGGAGCTGGG + Intergenic
1160160688 18:76467614-76467636 CCAGTTAGGAAGGAGCAGCAGGG - Intronic
1160211376 18:76883085-76883107 AAGGTCTGGAAGGAGCAGCACGG - Intronic
1160982017 19:1820546-1820568 AAGGCAAGACAGGAGCAGCAGGG + Intronic
1161398110 19:4055346-4055368 AATGTGAGGCTGGGGGAGCAGGG - Intronic
1162845267 19:13387510-13387532 AGAGTTAACCAGGAGCAGCATGG - Intronic
1165453369 19:35897719-35897741 AATTTTCGGCAGCAGAAGCAGGG + Exonic
1168102192 19:54147253-54147275 AATGTTAGGCAGGAGCAGCATGG + Intronic
1168667430 19:58215004-58215026 AGTATTAGGCAGAAACAGCATGG + Intergenic
1168703117 19:58453259-58453281 AATGTCAGGCAAGCGCAGCAGGG + Intronic
925032361 2:660832-660854 GATGTAAGGCAGAAGCCGCAGGG + Intergenic
926274022 2:11389880-11389902 GCTGTTAGGCAGGGGCACCAGGG + Intergenic
926561403 2:14421292-14421314 CACATTAGGCAGGAGAAGCAAGG - Intergenic
927098530 2:19767491-19767513 AATCTTAAGCAGCAGCAGCATGG + Intergenic
927922893 2:26987072-26987094 AGAGATAGGCAGGAGCAGAATGG - Intronic
931200550 2:60093302-60093324 CATTTTAGGCAGGGGAAGCATGG + Intergenic
937600661 2:123727571-123727593 AGGGTTAGGCAGGAGCAAGAAGG - Intergenic
937939043 2:127270925-127270947 AAGGTTTGGTAGGAGCAGCTTGG - Intronic
939087813 2:137742826-137742848 TCTGGCAGGCAGGAGCAGCAGGG - Intergenic
940948218 2:159643322-159643344 CATGTTAGGAAGGAGCAAGATGG - Intergenic
944847456 2:203682932-203682954 TATGTTTGGGAGGGGCAGCAAGG - Intergenic
947398968 2:229714061-229714083 ATTGTCGGGCAGCAGCAGCAGGG + Intronic
1169275213 20:4229083-4229105 GATGTGAGGAAGGAGCAGCAAGG - Intronic
1169700721 20:8443717-8443739 AATGTGATGCAGAAGCAGAAGGG - Intronic
1170121672 20:12919156-12919178 ATTGTTAGGCAGAAGGAGCGAGG - Intergenic
1172634277 20:36399388-36399410 AATGTGAGGCAGGCAGAGCAAGG - Intronic
1172773813 20:37396073-37396095 AATGTCAGGCAGGCACAGAACGG + Intronic
1173857306 20:46258598-46258620 AGCCCTAGGCAGGAGCAGCAAGG - Intronic
1175131726 20:56794479-56794501 GATGTTAGCCAAGAGCACCATGG - Intergenic
1175286788 20:57841868-57841890 AACTTTAGGCAGGAAAAGCAGGG + Intergenic
1178468315 21:32869303-32869325 AATGTTAGCCAGGAGTACTAGGG + Intergenic
1181295118 22:21831731-21831753 ACTGGTAGGCAGGAGAAGAAGGG - Intronic
1181882070 22:25989100-25989122 AGTGTCATGCAGGAGCAGCAAGG - Intronic
1182550521 22:31098626-31098648 CATGTTAGGCAGGGAGAGCAGGG - Intronic
1183014429 22:34974221-34974243 AATGTTTGGCAGCAGCAACTAGG - Intergenic
1183192889 22:36332983-36333005 AATGTTAGGTAGGAGCAAGGCGG - Intronic
1183247931 22:36708294-36708316 ACTGTGAGGCAGGAGCAGGTTGG + Intergenic
1184017018 22:41793975-41793997 AATGGAAGGCTGGAGCAGGAGGG - Intronic
1184198488 22:42948078-42948100 ATTCTTCAGCAGGAGCAGCAAGG + Intronic
1185205782 22:49537461-49537483 AATGATAGGCTGGGGCCGCAGGG - Intronic
950092397 3:10305142-10305164 ACTGTTAGGGAGGAGGAGGACGG - Exonic
952709580 3:36416178-36416200 AATGTTAGTCAGGCCAAGCATGG + Intronic
953302816 3:41796013-41796035 AAGGTTAGGAAGGAGCATTAAGG - Intronic
954422095 3:50424224-50424246 CCTCTTAGGCAGGTGCAGCATGG - Intronic
955671696 3:61409267-61409289 AAAGTTAGGCAGGGGAAGAAAGG - Intergenic
956290052 3:67651614-67651636 AGTGACAGGCAGGAGCACCAGGG + Intronic
957941008 3:87003549-87003571 ATTGGTAGGCAAGATCAGCATGG + Intergenic
961219158 3:125186402-125186424 ATTTTTAGGCAGCAGGAGCAGGG - Intronic
961396854 3:126599463-126599485 AATTTTAAGTATGAGCAGCATGG - Intronic
963408368 3:144898365-144898387 TATGTCAGGAAGGAACAGCATGG + Intergenic
963979925 3:151526107-151526129 AATGTTAGCCAGAAGTATCATGG - Intergenic
964958988 3:162399778-162399800 AATGTTATTCAGGAGCATAAGGG - Intergenic
966269080 3:178083343-178083365 GATGTTAGAGAGGAGAAGCAAGG - Intergenic
966877995 3:184334610-184334632 AATGTCAGGCTGGTGCATCAGGG + Intronic
967095606 3:186174957-186174979 AGAGTTAGGAAGGAGAAGCAGGG + Intronic
969671450 4:8592488-8592510 GGTTTTAGGCAGGATCAGCAGGG + Intronic
972195502 4:36648963-36648985 AATGTTGGGAGGGAACAGCATGG + Intergenic
976086306 4:81410469-81410491 GATGTGAGGCATTAGCAGCAAGG - Intergenic
976610242 4:87023644-87023666 AATGTTTTGCAGAAGCAGCAAGG + Intronic
980558955 4:134446422-134446444 AATTTTAGGCATGAGAAGCCTGG + Intergenic
980735915 4:136887965-136887987 AATGTTACACAAGAGCAGGAAGG + Intergenic
981340387 4:143615520-143615542 AAGGCTCGGCTGGAGCAGCATGG + Intronic
981362501 4:143863754-143863776 AAGGTAAGGAAGGTGCAGCAGGG + Intergenic
981373230 4:143984523-143984545 AAGGTAAGGAAGGTGCAGCAGGG + Intergenic
984633038 4:182080699-182080721 AAAGTTGGGCAGGCCCAGCATGG + Intergenic
985543952 5:500003-500025 GCTGTTGGGCAGGAGCTGCAGGG + Intronic
987992051 5:25225622-25225644 AGTGTTTGGGAGGAGCAGGAAGG - Intergenic
988689948 5:33561892-33561914 AGTGTTAGGGAGGAGAGGCAAGG - Intronic
990277863 5:54218006-54218028 AATGTTAGGCAGTATTTGCAGGG + Intronic
993362662 5:86997518-86997540 AATCCTAGGCAGCTGCAGCATGG - Intergenic
993436714 5:87904807-87904829 AAATTAAGGCAAGAGCAGCAAGG + Intergenic
994871900 5:105362292-105362314 TGTGATAGGCAGGGGCAGCATGG - Intergenic
995466477 5:112454520-112454542 TATGTAGGGCAGGGGCAGCATGG - Intergenic
996513799 5:124347465-124347487 AATCTCAGGCAGAAGCTGCAAGG - Intergenic
997702088 5:135909644-135909666 AATGGTAGGGAGAGGCAGCAGGG + Intergenic
998490000 5:142538571-142538593 AGTGTTTGTCAGGAGCTGCAGGG + Intergenic
998848690 5:146334633-146334655 ACAGTTAGGCAGTAGTAGCATGG - Intronic
999186010 5:149709529-149709551 ATTTTTAGGCAGGAGCACAATGG + Intergenic
1000295372 5:159908922-159908944 ACTTTTAGACAGGAGCAGCCTGG - Intergenic
1001514818 5:172348007-172348029 AATGTTGGCCAGGTTCAGCACGG + Intronic
1002432940 5:179213564-179213586 AAGGAGAGGCAGGTGCAGCAGGG + Intronic
1003045953 6:2732851-2732873 AATGTTTGGAAGGAACAGCCAGG - Intronic
1005928328 6:30463209-30463231 AGTGTGAGGAAGGAGGAGCATGG - Intergenic
1005941601 6:30564451-30564473 AATTTTAGACAGGAGTATCATGG + Intergenic
1006778917 6:36618585-36618607 GATGTGTGGCAGCAGCAGCAAGG - Intergenic
1007258061 6:40542361-40542383 AATGCTGGGCAGGAGGAGGAGGG + Intronic
1007794751 6:44338526-44338548 AATGGTAGGCAGAAGAAGCCTGG - Intronic
1010471122 6:76229862-76229884 AATGTGAGGGAGGAGCAACCAGG + Intergenic
1010714305 6:79210459-79210481 AACGTGAGGCAAGACCAGCATGG - Intronic
1011007186 6:82659076-82659098 AAAGATAGGCATGTGCAGCATGG - Intergenic
1011032228 6:82936171-82936193 AATCTTTGGCAGGGGCAGGATGG - Intronic
1011646153 6:89459939-89459961 AATTTTATACAGTAGCAGCATGG - Intronic
1012389006 6:98715960-98715982 TATGATAAGCAGGAGCAACAAGG + Intergenic
1012659572 6:101871068-101871090 TTTGTCAGGCAGGAGCAGAAAGG + Intronic
1015731333 6:136351279-136351301 AATGCTAGGCAGGAGAAGATGGG + Intronic
1015977331 6:138803763-138803785 AATGTTACAGACGAGCAGCATGG - Intronic
1016314439 6:142770878-142770900 CATGTTATTCAGGAGCATCAGGG - Exonic
1019429524 7:992285-992307 AATGGGAGGCACGTGCAGCACGG - Intergenic
1019863869 7:3686749-3686771 AATGGCAGGCAGGAGCTGCAGGG + Intronic
1020941336 7:14542309-14542331 AAAGTTAGGAAAAAGCAGCAGGG - Intronic
1021415190 7:20376061-20376083 AATGTTAGGGAGGGGAAGGAAGG - Intronic
1021526260 7:21592392-21592414 ACTTTGAGGCAGGAGCAGCCTGG + Intronic
1021555525 7:21914538-21914560 ACAGATAGGCAGGAACAGCATGG + Intronic
1021582367 7:22170049-22170071 AATATTAGACACAAGCAGCAAGG + Intronic
1022339453 7:29454662-29454684 ATTTTTGGGCAGAAGCAGCAGGG - Intronic
1022588862 7:31642280-31642302 GATGTTAGGGATGAGCAACAGGG - Intronic
1022649186 7:32259241-32259263 AAGGTTGGGGAGGGGCAGCACGG + Intronic
1022878276 7:34558767-34558789 AAATTTAGACAGGAGCAGCAAGG + Intergenic
1026186871 7:68088907-68088929 ACTGTTAGGCAGCAGAACCAAGG - Intergenic
1027650910 7:80867627-80867649 AAAGTCAGGGAGGAACAGCAGGG + Intronic
1028390433 7:90310650-90310672 AATGTAAGCCAGGAGCTGCTAGG - Exonic
1029652962 7:101906327-101906349 GAGGTGAGGCAGGAGGAGCAGGG + Intronic
1029946045 7:104534051-104534073 AATTTAAGGCAGCATCAGCAGGG - Intronic
1030444142 7:109627476-109627498 AATATTAGGAAGGATCATCATGG + Intergenic
1030903502 7:115153191-115153213 AATATAAGGCAGTATCAGCAAGG - Intergenic
1031819829 7:126486245-126486267 AAGGTGAGGCAGGAGCATGAAGG - Intronic
1033831929 7:145265393-145265415 AATGTTGGTCAGCAGCAGCTGGG - Intergenic
1033908812 7:146240159-146240181 AAATTTAGGCAGGAGCTTCATGG - Intronic
1034181352 7:149140887-149140909 AAAGTTAGCCAGGTGTAGCAGGG + Intronic
1034679526 7:152918173-152918195 AGTGTTAGGCAGGAGAAGAGTGG - Intergenic
1036076497 8:5508058-5508080 AATGTGAGGTATGAGCAGGATGG - Intergenic
1038069399 8:23996867-23996889 AATGTTAGGTAGGATCTGGATGG + Intergenic
1039078209 8:33711341-33711363 AATGGAAGGAAGGAGAAGCAAGG - Intergenic
1039697975 8:39932421-39932443 AGTGGTGGGCAGAAGCAGCAGGG - Intergenic
1041533928 8:58904634-58904656 ACTCTTAAGCAGTAGCAGCAGGG + Intronic
1043284530 8:78513325-78513347 TGTGTATGGCAGGAGCAGCAGGG - Intergenic
1043834485 8:85031570-85031592 AATATAAGGCAAGAGCAGCTGGG + Intergenic
1044852401 8:96441919-96441941 AGGCTTAAGCAGGAGCAGCATGG + Intergenic
1047530354 8:125668495-125668517 ACTGTTAGGTAGGAGCACAAAGG - Intergenic
1047639022 8:126798381-126798403 CATTTTAGCCAGGAGCATCAAGG - Intergenic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1052858204 9:33420221-33420243 AATGTGTGGCTGGAGCAGGATGG + Intergenic
1054881032 9:70145028-70145050 ATTGCTAGGCAGGAATAGCATGG + Intronic
1055947083 9:81701285-81701307 AATGTCATGCAGGCCCAGCACGG - Intergenic
1060154917 9:121312915-121312937 AAAGTGAGGCAGGGCCAGCATGG - Intronic
1062518095 9:136945997-136946019 AAGGTGAGGCAGGGGCTGCAGGG + Exonic
1062519419 9:136951566-136951588 TCTTTTAGGCAGGACCAGCATGG + Intronic
1062608195 9:137358194-137358216 AGTGTTGGGCAGGAGCAGTTAGG - Intronic
1186969046 X:14820051-14820073 AATGTAAGGCTGGAGAAGGAAGG - Intergenic
1189065699 X:37805998-37806020 AATGTCTGGCAGTAGCAGCCAGG + Intronic
1189912007 X:45819661-45819683 AATGATTGGAAGGAGAAGCAGGG + Intergenic
1196888646 X:120271250-120271272 AATGTTAGTCAGGGGCAGCTGGG + Intronic
1197873845 X:131084022-131084044 AATGTGAGGCCGGAGGATCAAGG + Intronic