ID: 1168102665

View in Genome Browser
Species Human (GRCh38)
Location 19:54149307-54149329
Sequence GGATTCTCGGGTGCTCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168102665 Original CRISPR GGATTCTCGGGTGCTCCACC AGG (reversed) Intronic
910916051 1:92290583-92290605 AGATTCTCAGGGGCTCCAGCAGG + Intronic
915740933 1:158117956-158117978 GGATTCTCTGCAGCTCCCCCTGG - Intergenic
917838677 1:178960214-178960236 GGCTTCTTGGGTGCTCCCCATGG - Intergenic
920515783 1:206583896-206583918 GGATTTTCTGGTGCTCCATCTGG - Intronic
924946137 1:248848165-248848187 GGATGCGCTGGTGCACCACCAGG - Exonic
1063143679 10:3277026-3277048 GGAGTCTCGGGTGTTCCTTCTGG + Intergenic
1063950985 10:11223327-11223349 GTATGCTGGGGTGCTCCACAAGG - Intronic
1067761300 10:49049079-49049101 GGGTTCTGGGGAGCTGCACCTGG + Intronic
1072151564 10:92689274-92689296 GGACTCTTGGCCGCTCCACCTGG - Intergenic
1080653399 11:34240346-34240368 GGAGTCTCGAGCGATCCACCTGG + Intronic
1089791357 11:120946929-120946951 GGAGTCTCGGGTGTTCTAGCTGG - Intronic
1091340524 11:134809084-134809106 CAAATCTCGTGTGCTCCACCTGG + Intergenic
1095559792 12:43551702-43551724 GGAGTCCCGGGAGCTCCAGCAGG + Intronic
1101852439 12:108414725-108414747 TGGTTCTCAGGTGCTTCACCGGG - Intergenic
1103763787 12:123268368-123268390 GGGTTCTCCAGTGCTCCTCCCGG - Intronic
1113963026 13:114135837-114135859 GGCTTCTCTGGTGCTCCTGCTGG + Intergenic
1126780294 15:52133906-52133928 GGACTCTCGGCTGCTCCATTTGG - Intronic
1129718313 15:77864520-77864542 GGATTCTCTGGGTCTCCCCCAGG - Intergenic
1130121199 15:81049086-81049108 GGATTCTCTTGTTCTCCACTCGG - Intronic
1140306423 16:73807116-73807138 CTCTTCTCGGGTGCTCCAGCTGG - Intergenic
1142296647 16:89227761-89227783 GGATTCTCGCGTGCTCAGTCAGG - Exonic
1143473104 17:7188444-7188466 TGATTCTCAGGTGCTCCAGTGGG - Intergenic
1148332193 17:46819531-46819553 GGATTCTCGGTTGGACCATCAGG + Intronic
1151207769 17:72520826-72520848 GGTGTCTCGGGTGCTTCTCCTGG - Intergenic
1151584723 17:75002115-75002137 GGCCTCTCAGTTGCTCCACCTGG - Exonic
1152565005 17:81096453-81096475 GGATGCTGGGGTGCGCCTCCAGG - Intronic
1152888962 17:82869100-82869122 GGAGGCTTGGGTGCTCCCCCTGG + Intronic
1161304510 19:3559495-3559517 TGATTCTCTGCTGCTCCACTTGG + Intronic
1165902580 19:39175577-39175599 TGACTCTGGGCTGCTCCACCAGG - Intronic
1167476897 19:49706439-49706461 GGATTCTCGGGTGCCACATCTGG - Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168401652 19:56088826-56088848 GGATGCGCCGGTGCTGCACCAGG + Exonic
1168491739 19:56816689-56816711 GGATTTTCTGGTGCTCAATCAGG + Exonic
926059536 2:9796518-9796540 GGATGCTCGGGGGGTCCTCCAGG - Intergenic
930853255 2:55984714-55984736 GGCTTCTCAGGTGCTCCTCCTGG - Intergenic
934924969 2:98375841-98375863 GGAATCTCGGCTGTACCACCTGG + Intronic
936625978 2:114149876-114149898 TGATTCTCTGTGGCTCCACCTGG + Intergenic
937877903 2:126839301-126839323 GGATTTTAGGGGACTCCACCTGG - Intergenic
942103944 2:172614116-172614138 AGATTCCCGGGTTCTACACCTGG - Intergenic
948190128 2:236051819-236051841 GGCTTCCCGCATGCTCCACCAGG - Intronic
1170775762 20:19373395-19373417 GGGTTCTCGAATGTTCCACCAGG - Intronic
1173900849 20:46587996-46588018 GGATTCTGGGCTGGGCCACCTGG - Intronic
1180722656 22:17920859-17920881 GGAATCTCGGGGCTTCCACCAGG - Intronic
1183735616 22:39643328-39643350 GAATTCCAGGGAGCTCCACCGGG - Intronic
1185111976 22:48905266-48905288 GGCTTCTCCTGTGCCCCACCAGG - Intergenic
953339763 3:42123484-42123506 AGATCCTGGGGTGCTCCACACGG - Intronic
961594643 3:128006764-128006786 GGCTTTGCGGATGCTCCACCTGG - Intergenic
962152140 3:132904215-132904237 GGATTCTTGGGTGATCCTCCTGG - Intergenic
997179892 5:131817234-131817256 GGCTTCTCTGGTTCTCCAGCTGG + Intronic
999096562 5:148983489-148983511 GGTTTCTTGGGACCTCCACCTGG - Intronic
1006239118 6:32661991-32662013 GGAGGCTGGGGTGCTCCACGTGG + Exonic
1006248258 6:32758874-32758896 GGAGGCTGGGGTGCTCCACTTGG + Exonic
1012221430 6:96653613-96653635 GCAGTCTCGGGTTCCCCACCAGG + Intergenic
1019550672 7:1600914-1600936 GGAATCTTGGCTGGTCCACCAGG - Intergenic
1020016656 7:4835449-4835471 GGTCTCTCGTGTGCTCCTCCGGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1023725105 7:43135264-43135286 GCATTCTCAGGAGCTCCACCTGG - Intronic
1027691777 7:81355553-81355575 TGCTTCTCTGGTGCTACACCTGG - Intergenic
1029307268 7:99629552-99629574 GGGTTCTCTGGTGCTTCATCAGG - Exonic
1034461197 7:151198967-151198989 TGATGCTCAGGTGCTCTACCTGG + Exonic
1037611957 8:20483320-20483342 GGGTCCTGGGGTGCTCCTCCTGG + Intergenic
1053419670 9:37969529-37969551 GGAGTCTCAGTTTCTCCACCTGG - Intronic
1058633572 9:107014698-107014720 GGAGTCTGGGTTGCTCCATCTGG + Intergenic
1060594630 9:124840710-124840732 GGATTCTCGAGTTCCCCAGCTGG + Intergenic
1061801856 9:133117084-133117106 GGCTCCTCGGGTGCGTCACCTGG - Intronic
1199616608 X:149660763-149660785 TGATCCTCGGGTGCTCCAGAGGG + Intergenic
1199626033 X:149742485-149742507 TGATCCTCGGGTGCTCCAGAGGG - Intergenic
1200337293 X:155363678-155363700 GGCTTCTCAGGTGCTCAACCAGG - Intergenic
1200349177 X:155477549-155477571 GGCTTCTCAGGTGCTCAACCAGG + Intergenic