ID: 1168104568

View in Genome Browser
Species Human (GRCh38)
Location 19:54158799-54158821
Sequence GGGGTAGTCACTTGGAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168104568_1168104573 10 Left 1168104568 19:54158799-54158821 CCATGGCTCCAAGTGACTACCCC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1168104573 19:54158832-54158854 AAGCCCTGTCCCCTGCCTTCAGG 0: 1
1: 0
2: 3
3: 81
4: 432
1168104568_1168104576 16 Left 1168104568 19:54158799-54158821 CCATGGCTCCAAGTGACTACCCC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1168104576 19:54158838-54158860 TGTCCCCTGCCTTCAGGACGCGG 0: 1
1: 0
2: 0
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168104568 Original CRISPR GGGGTAGTCACTTGGAGCCA TGG (reversed) Intronic
900291126 1:1924084-1924106 GGGGTGGGCGCTTGGATCCATGG - Intronic
900702267 1:4055714-4055736 GGGTAACTCCCTTGGAGCCATGG + Intergenic
901228381 1:7628259-7628281 GTTGGAGTCACTTGGAGGCAGGG - Intronic
902076716 1:13792913-13792935 GGGGTCTCCACTTGTAGCCATGG - Intronic
902442599 1:16440842-16440864 TGGGTAGTCACCTGTAGCCACGG - Exonic
903128207 1:21261953-21261975 GGCGTAGTCACTTGGAGCAAAGG + Intronic
903865438 1:26394229-26394251 GGGGAAGGGACTGGGAGCCATGG + Intergenic
903913102 1:26743101-26743123 GGGTAAGGCACTGGGAGCCAGGG - Intronic
914867184 1:151441102-151441124 GGCATAGTCACTTGGAGACAGGG + Intronic
915170505 1:153973945-153973967 GAGGGAGCCACCTGGAGCCAAGG + Exonic
916662463 1:166935317-166935339 AGTGGAGTCACTTGGTGCCAAGG + Exonic
917277569 1:173347094-173347116 AGGTTAGTAACTTGGAGTCAGGG + Intergenic
920069376 1:203291232-203291254 CAGGTGGTCACTTGGTGCCAGGG + Intergenic
921432565 1:215082131-215082153 GGGGAACGCACCTGGAGCCAGGG - Intronic
923175515 1:231460617-231460639 GGGGTAGTGGAGTGGAGCCAGGG + Intergenic
1063076941 10:2726594-2726616 AGTCTAGCCACTTGGAGCCAAGG - Intergenic
1065655024 10:27939487-27939509 GGGAGAATCACTTGAAGCCAGGG + Intronic
1068121123 10:52782852-52782874 GATGTTGTCAGTTGGAGCCATGG - Intergenic
1068228352 10:54136365-54136387 GAGGAAGTCTCTTGGATCCAGGG - Intronic
1070549770 10:77481991-77482013 AGGGTAGGCACTTTGTGCCAGGG - Intronic
1070626103 10:78052559-78052581 GAGGTAGGCACCTGGAGCGAAGG + Intronic
1073352830 10:102832020-102832042 GTGGTAGAGACATGGAGCCACGG + Intronic
1077922164 11:6649729-6649751 GGGGTAGTGACATGCAGCAAGGG + Intronic
1078452264 11:11449207-11449229 GGGGTCCTGACTTGAAGCCATGG - Intronic
1079193872 11:18306755-18306777 GAGGAAGTGACTTGGAGACAGGG - Intronic
1083323716 11:61862905-61862927 GGGGCACGCACTTGGTGCCAGGG + Intronic
1083380675 11:62265830-62265852 GGGGAATCCACTTGGAGCAAAGG + Intergenic
1083483788 11:62968969-62968991 AGGGGAGTCACTTGAAGCCAGGG + Intronic
1083755745 11:64790676-64790698 GGAGGAGTCACGGGGAGCCACGG + Intronic
1083764224 11:64834397-64834419 GGGGCAGGCACTGGGGGCCAGGG - Intronic
1083772704 11:64877502-64877524 GGGGCAGCCCCTTGGAGGCAGGG - Intronic
1085694454 11:78692087-78692109 GAGGCAGCCACTTGGAGCCCAGG - Intronic
1087328879 11:96755178-96755200 GTGGTAGTCATTTGGAGGAAAGG + Intergenic
1089156908 11:116409643-116409665 GGGGGAGACATTTGGGGCCATGG - Intergenic
1091416897 12:295701-295723 GGAGTTGTCACCTGGAGCTAAGG - Exonic
1092831910 12:12452501-12452523 CGGGTAGGCACTGGGGGCCAGGG + Intronic
1092954298 12:13535259-13535281 GGGGTGCTCAGCTGGAGCCAGGG - Intergenic
1100045493 12:90375517-90375539 GGGAGAATCACTTGAAGCCAGGG + Intergenic
1103272779 12:119687470-119687492 GAGGCAGTGACTTGGGGCCAAGG - Exonic
1105320680 13:19318417-19318439 TGGGTAGCCACTTGTTGCCATGG - Intergenic
1106038078 13:26063368-26063390 GGGTTAGGCACAGGGAGCCATGG + Intergenic
1109865128 13:68254201-68254223 GAGGAAATCACTTGAAGCCAAGG + Intergenic
1110565056 13:76949597-76949619 GGGGTGGTGACATGGAGCCCTGG - Intronic
1113146516 13:107214164-107214186 TGGGAAGTGTCTTGGAGCCATGG - Intronic
1115126973 14:30007558-30007580 GGGAGAATCACTTGGACCCAGGG - Intronic
1115530538 14:34322912-34322934 GGGGCAGTCACTGTGAGCAATGG + Intronic
1115882833 14:37939427-37939449 GCGATGGTCACTTGGAGTCATGG + Intronic
1120171254 14:81248797-81248819 GGGGTAAAGAATTGGAGCCAGGG - Intergenic
1121018937 14:90567116-90567138 GGGGTGCTGACCTGGAGCCAAGG - Intronic
1121320485 14:92988989-92989011 GGGGTGGGGACTTGGAGTCAAGG - Intronic
1124665418 15:31587767-31587789 GGCGAAGTCACTTGGTGCCCGGG - Intronic
1125779960 15:42256364-42256386 GGGTGAATCACTTGAAGCCAGGG - Intronic
1129298747 15:74613750-74613772 GGGCTAGTATCCTGGAGCCATGG + Intronic
1129350106 15:74951089-74951111 GAGGGAGCCACTGGGAGCCAGGG - Intergenic
1129896286 15:79109182-79109204 GGGGTAGCCACATAGAGCAATGG + Intergenic
1130000120 15:80039012-80039034 GGGGGAGTCAGCTAGAGCCATGG - Intergenic
1132732366 16:1368971-1368993 TGGGTGGTCACTTGAGGCCAGGG - Intronic
1135771414 16:25221095-25221117 GGGCTACTAACTTGGAGCCTTGG + Intronic
1135888480 16:26335510-26335532 GGGGTAGAAACTTCGAGCCACGG - Intergenic
1139268351 16:65660200-65660222 CGTGTAGTCACTGGGATCCAGGG - Intergenic
1141770288 16:86085603-86085625 AGGGTGGTCACTGGGAGCCTGGG - Intergenic
1142065465 16:88059879-88059901 GATGGAGTCACCTGGAGCCACGG + Intronic
1143867202 17:9932649-9932671 GGGAGAGTCACTTGGAAACATGG + Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144409618 17:14988030-14988052 GGGGAAATCACCTGTAGCCAAGG + Intergenic
1146351796 17:32101625-32101647 GGGGAAGACACATGGAGCTAGGG - Intergenic
1149002658 17:51773357-51773379 GGGGTAGTCTCTTAGAGACAGGG + Intronic
1153661786 18:7332045-7332067 GAGGAAGTTACTTGTAGCCAGGG - Intergenic
1156462984 18:37332107-37332129 GGGGAAGGCACCTGGTGCCAAGG - Intronic
1159854456 18:73567294-73567316 TTAGTAGTCACTTGGAGACAGGG + Intergenic
1160728741 19:630718-630740 GGTGTAGACACTGGGAGCCTAGG - Intronic
1161333732 19:3700144-3700166 GGGGCAGTCCCCTGGAGCCGCGG - Intronic
1165473605 19:36017139-36017161 GGGATAGTCACTGGGGGACATGG - Intronic
1167862734 19:52298140-52298162 GGGGGAGGGATTTGGAGCCAGGG + Intronic
1168104568 19:54158799-54158821 GGGGTAGTCACTTGGAGCCATGG - Intronic
927049898 2:19317049-19317071 GGGTGAATCACTTGAAGCCAGGG - Intergenic
931171479 2:59808170-59808192 GGACTGGTCACTTGGAGCCAGGG + Intergenic
932818415 2:74879689-74879711 GTAGTGGCCACTTGGAGCCATGG - Intronic
934646044 2:96059968-96059990 GGGGTAGTGTCTTGGAGGCGGGG - Intergenic
934839448 2:97616058-97616080 GGGGTAGTGTCTTGGAGGCGGGG - Intergenic
936522557 2:113220285-113220307 TGGGGAGACAGTTGGAGCCACGG + Intronic
937252610 2:120534085-120534107 GTGGCAGTGAGTTGGAGCCAGGG + Intergenic
937831016 2:126423475-126423497 GGGAAAGTCACTTGAGGCCAGGG + Intergenic
937843238 2:126548265-126548287 GCGGTAGCCACTGGTAGCCACGG + Intergenic
938454174 2:131446893-131446915 GGGGTTGGCCCTAGGAGCCAGGG + Intergenic
938981604 2:136532284-136532306 GGGGTAGTCACTTAAATTCAGGG - Intergenic
939182255 2:138817279-138817301 GGGATAATAACTTGAAGCCAGGG + Intergenic
942681143 2:178479546-178479568 TGGGTATTCACTTGGAAACAAGG - Intergenic
943618417 2:190119744-190119766 GGGATTGTTACTGGGAGCCAAGG - Intronic
944673995 2:202019984-202020006 AGGGTAATCTCTTGGAGCCATGG + Intergenic
945251044 2:207767069-207767091 GGGGTAGTCCCCTGCGGCCATGG + Exonic
946966896 2:225045360-225045382 TGGGTATTATCTTGGAGCCAAGG + Intergenic
948106049 2:235414585-235414607 GGGCTTGTCACATGGTGCCATGG - Intergenic
1170161874 20:13321434-13321456 GGGATTGTCGCTTGGATCCAAGG + Intergenic
1179452691 21:41476360-41476382 GGGGGTGTCCCTTGGACCCAAGG + Intronic
1180611015 22:17097980-17098002 GGGAGAGCCACTTGGAGGCAGGG - Intronic
1184118250 22:42434354-42434376 GGGGTAGCCTCTGGGAGGCAGGG + Intergenic
1184421354 22:44384549-44384571 GGGGCAGTCACTTAGGGCCAGGG + Intergenic
949339199 3:3010187-3010209 GGGTTAGTCACCTGGATGCATGG + Intronic
951933175 3:27992901-27992923 GGGGCAGTCAGTAGGAGTCATGG - Intergenic
959366877 3:105471942-105471964 GGGGTAGTCATTGGGAGAGAAGG - Intronic
961338615 3:126201728-126201750 GGGAGAATCACTTGAAGCCAGGG + Intergenic
961792680 3:129387502-129387524 GGGGTCTTCACCTGAAGCCAAGG + Intergenic
961806602 3:129493761-129493783 GGGGTCTTCACCTGAAGCCAAGG + Intronic
966541362 3:181093712-181093734 GGGGAAGTCGCTTGGAGAAATGG + Intergenic
967853217 3:194097631-194097653 GGGGTAGTCCCCCGGGGCCAAGG - Intergenic
967987589 3:195106909-195106931 AGAGTAGACACTTGGAGCCCTGG + Intronic
968450791 4:675066-675088 GGGGCAGGCCCTTGGAGCCGTGG - Intronic
969373787 4:6750053-6750075 AGGGGAGTCACTTGAAGCCAGGG + Intergenic
970709632 4:18846833-18846855 GGGGTTGGCATTTGGAGCAATGG - Intergenic
973375129 4:49281113-49281135 TGGATAGTAACTGGGAGCCACGG + Intergenic
973382282 4:49329128-49329150 TGGATAGTAACTGGGAGCCACGG - Intergenic
977584571 4:98760641-98760663 GGGGTAGTGAGTGGGAGACAAGG - Intergenic
979016734 4:115443853-115443875 GTGGTTGTAACTTGAAGCCAGGG - Intergenic
990997351 5:61745859-61745881 GGGCTACTCAATAGGAGCCATGG - Intronic
992077587 5:73205509-73205531 GGAGTAGTCCCTTGGGGCCCAGG + Intergenic
994327036 5:98460059-98460081 GGCCTGGTCACTTGGATCCAGGG - Intergenic
994831794 5:104793077-104793099 GGCGTTGTTACTTGGATCCAAGG + Intergenic
997363177 5:133308232-133308254 GGGGGAGTCACTGGCACCCATGG + Intronic
997592461 5:135083953-135083975 GGGGCAGTCACTTGGCTGCAGGG + Intronic
997902689 5:137782002-137782024 TTGGGAGTCACTTGGGGCCAGGG + Intergenic
1003475345 6:6476873-6476895 GGGGTAGTCAATTCTAGCCCTGG + Intergenic
1017169203 6:151440046-151440068 GGGATAATCACTTGAATCCAGGG - Intronic
1019636986 7:2081250-2081272 AGAGGAGTCACTTGGGGCCAGGG + Intronic
1024464850 7:49701102-49701124 GGGGAAGTCACCTGCTGCCAGGG + Intergenic
1026895267 7:74006731-74006753 GTGGAGGTCACTGGGAGCCATGG - Intergenic
1029243323 7:99180161-99180183 CGGGAAGTCACTTGGACACATGG - Intronic
1029730471 7:102434784-102434806 GTGGAAGACACTTGGAGCCTGGG - Intronic
1031254172 7:119427643-119427665 CGGGGAGCCACCTGGAGCCAAGG + Intergenic
1038115830 8:24554056-24554078 GGGGAAGAAACGTGGAGCCATGG + Intergenic
1038589824 8:28826526-28826548 GTAGGGGTCACTTGGAGCCATGG - Intronic
1046596153 8:116263673-116263695 GGAGTAGTCACTAAGAGCAAAGG + Intergenic
1047949474 8:129918657-129918679 GTGGTAGCCACTTTGAGTCATGG - Intronic
1050173880 9:2850443-2850465 GGGGTAGACTCTGGCAGCCATGG - Intergenic
1051251809 9:15167270-15167292 GGGGGCGTCACTTGGGACCAGGG - Exonic
1052349338 9:27442608-27442630 GGGGAGGTCCCTTGGAGCCAAGG - Intronic
1053479284 9:38404019-38404041 GGGGTTTTCACTTGGATCCCTGG - Intergenic
1055347908 9:75356421-75356443 GGGGTAGTGACATGGAGAAAAGG + Intergenic
1055953819 9:81755474-81755496 GGGGTAGGGACTTATAGCCAAGG - Intergenic
1056988867 9:91390994-91391016 GGAAGAGTCACTTGAAGCCAGGG - Intergenic
1057353834 9:94319766-94319788 GAGGGAGTAACCTGGAGCCAAGG + Intronic
1057653917 9:96937826-96937848 GAGGGAGTAACCTGGAGCCAAGG - Intronic
1058166478 9:101624916-101624938 GGTGGTGTCACCTGGAGCCAGGG + Intronic
1185716684 X:2348352-2348374 GGGTCAGTCGCTTGCAGCCAGGG + Intronic
1192206597 X:69100672-69100694 GGGGGAGCCAATTAGAGCCAGGG + Intergenic
1195757193 X:108211064-108211086 GGGCCAATCATTTGGAGCCAGGG + Intronic
1195763265 X:108269975-108269997 GGAGTTGTCCTTTGGAGCCATGG + Intronic
1197280409 X:124529101-124529123 AGGGTAGTCACCTGGAGACTAGG + Intronic
1197727968 X:129788717-129788739 GGGAAACTCACTTGCAGCCACGG + Intronic