ID: 1168105035

View in Genome Browser
Species Human (GRCh38)
Location 19:54161252-54161274
Sequence GAGGGTAAGCTGGTGGGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 783
Summary {0: 1, 1: 0, 2: 5, 3: 66, 4: 711}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168105023_1168105035 13 Left 1168105023 19:54161216-54161238 CCGGAAGGTGCGGGCAGCCGGGG 0: 1
1: 0
2: 1
3: 19
4: 220
Right 1168105035 19:54161252-54161274 GAGGGTAAGCTGGTGGGGGAAGG 0: 1
1: 0
2: 5
3: 66
4: 711
1168105017_1168105035 23 Left 1168105017 19:54161206-54161228 CCGCGGAGGCCCGGAAGGTGCGG 0: 1
1: 0
2: 1
3: 5
4: 128
Right 1168105035 19:54161252-54161274 GAGGGTAAGCTGGTGGGGGAAGG 0: 1
1: 0
2: 5
3: 66
4: 711
1168105027_1168105035 -4 Left 1168105027 19:54161233-54161255 CCGGGGAGCAGGTGGAGAAGAGG 0: 1
1: 1
2: 6
3: 73
4: 648
Right 1168105035 19:54161252-54161274 GAGGGTAAGCTGGTGGGGGAAGG 0: 1
1: 0
2: 5
3: 66
4: 711
1168105021_1168105035 14 Left 1168105021 19:54161215-54161237 CCCGGAAGGTGCGGGCAGCCGGG 0: 1
1: 0
2: 1
3: 35
4: 472
Right 1168105035 19:54161252-54161274 GAGGGTAAGCTGGTGGGGGAAGG 0: 1
1: 0
2: 5
3: 66
4: 711

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168105035 Original CRISPR GAGGGTAAGCTGGTGGGGGA AGG Exonic
900124135 1:1062105-1062127 GAGGGAATGGTGGTGAGGGAGGG - Intergenic
900183179 1:1321316-1321338 CAGGGGAAGCTGGCGGGGGAGGG - Intronic
900351701 1:2238115-2238137 CAGGGCCAGCTGGTGAGGGAGGG - Intronic
900542886 1:3212826-3212848 GAGGCTGAGCTGGAGGGAGAGGG - Intronic
900707252 1:4088618-4088640 GAGGGTCAGAGGGTGGGAGATGG + Intergenic
900739022 1:4319217-4319239 GAAGGTGAGCTAGTGGGGGAAGG - Intergenic
901180752 1:7340324-7340346 GGGGGTAGGCTAGTGGGGGCAGG - Intronic
901522803 1:9798142-9798164 GAGGGGAAGAGGGAGGGGGAGGG + Intronic
901522812 1:9798160-9798182 GAGGGGAAGAGGGAGGGGGAGGG + Intronic
902155230 1:14479688-14479710 CAGTGTGAGATGGTGGGGGAGGG - Intergenic
902392793 1:16115962-16115984 GAGGCCCAGCTGGTGGGGGCGGG + Intergenic
902712414 1:18249475-18249497 GAGGGAAAGGTGGTGTGGGAAGG + Intronic
902828214 1:18992037-18992059 GCGGGCAAGGTGGTGTGGGAGGG - Intergenic
903278089 1:22234102-22234124 CTGGGGAAACTGGTGGGGGAGGG - Intergenic
903333974 1:22612836-22612858 GAGGGGAAGGTGGTGGCAGATGG - Intergenic
903445318 1:23419018-23419040 GGGGGAGAGCTGGTGGGGGAGGG - Intronic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903769745 1:25756414-25756436 GAGGGTGAGCATGTGGGGGTGGG + Intronic
903967448 1:27099613-27099635 CAGGGGAAGCTGCTAGGGGAAGG - Exonic
904014661 1:27410115-27410137 GAGGAGGAGCTGGTGGTGGATGG + Exonic
904047656 1:27618183-27618205 GAGGGCAGGCAGGAGGGGGACGG + Intronic
904396003 1:30222743-30222765 CAGGGTAAGATGGTGGAGTAGGG - Intergenic
904839617 1:33363995-33364017 GTGGGGGAGCAGGTGGGGGAGGG - Intronic
905733516 1:40311750-40311772 TAGGGTAAGCTGGTAAGGGCTGG - Intronic
906460919 1:46034725-46034747 GAGGTGAAGCTGTTGGGGGTGGG - Exonic
906566532 1:46805006-46805028 GAATGTATGCTGGTGGGGCAGGG + Intronic
906586601 1:46984105-46984127 GAGAGAAAGTTGGTGGGGGAGGG + Intergenic
907238851 1:53069648-53069670 GAGGGCAGCCTGGTGGGGGTTGG + Intronic
907726257 1:57023503-57023525 GAAGGGAAGCTGGTGGAAGAGGG + Intronic
907762926 1:57379170-57379192 TAGGAAAAGATGGTGGGGGAGGG - Intronic
907921428 1:58917154-58917176 GAGGGTAAGGTGGGTGGGGCAGG + Intergenic
910533063 1:88263142-88263164 GAGGTTAGCCTGCTGGGGGATGG + Intergenic
910620042 1:89243635-89243657 GAGGGTAGGGGGCTGGGGGAGGG - Intergenic
910678124 1:89835216-89835238 GAGGGCAGCCTGGTGAGGGAAGG + Intronic
911196752 1:95002394-95002416 GAGGCTGAGCGGGTTGGGGATGG + Intronic
911287577 1:96015493-96015515 GAGGGTTTGATGGTGGAGGATGG - Intergenic
911430262 1:97776021-97776043 GAGGGAAAGCAGGTGGGGAAAGG + Intronic
911661956 1:100511204-100511226 GTTGGTAGGCTGGTGGGGGCTGG + Intronic
912058273 1:105632357-105632379 GTGGGTAAGGTGGGGAGGGAAGG - Intergenic
912511051 1:110190379-110190401 GAGGGGAAAGAGGTGGGGGATGG - Intronic
913093920 1:115498469-115498491 GAGGGTAACCAGGTTGGGCAGGG - Intergenic
913331863 1:117674493-117674515 GGGGGTAAGGTGGATGGGGAAGG - Intergenic
914904733 1:151734598-151734620 GAGGGGAAGCAGGTAGGGGCAGG + Intergenic
915142300 1:153775249-153775271 GAGCGTAGGCTGTGGGGGGAGGG + Intronic
915444664 1:155967807-155967829 GAGGGGAAGCTGGAGAGGGCCGG - Intronic
915511775 1:156390598-156390620 GAGGGGACGCTGGTGTGGGGCGG - Intergenic
915585353 1:156841173-156841195 GAGGGTCAGTTGGTGGGAGTGGG + Intronic
916260168 1:162833991-162834013 GAGGGTAAGCAGGAGGTGGCAGG + Intronic
916392001 1:164341432-164341454 GATGGCTAGCGGGTGGGGGAGGG + Intergenic
916491326 1:165304913-165304935 GTGGGGCAGGTGGTGGGGGAAGG - Intronic
916544256 1:165786957-165786979 AAGGGGAAGATGGTGGGGGGGGG + Intronic
916863971 1:168836742-168836764 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
916888134 1:169090359-169090381 GAAGGTAAGAAGGTGGGGGGAGG - Intergenic
918471394 1:184878927-184878949 GAGGGGAAGTTGGGGAGGGAAGG + Intronic
918908306 1:190528964-190528986 GAGGGTATTTTGGTGGGGCATGG + Intergenic
919364056 1:196634200-196634222 GATGGTAAGGTGTTAGGGGAGGG - Intergenic
919757490 1:201075026-201075048 GAGGGTAAGGTGGATGGGGCCGG - Intronic
919770982 1:201158419-201158441 GAGGGCATTCTGGTGGGGGGTGG + Intronic
920446415 1:206022022-206022044 GAGTGGAAGCTGGTGTGGCAGGG + Intronic
920857735 1:209676438-209676460 GAGGGTGAGCAGGTGGGCGATGG + Intergenic
920894660 1:210034577-210034599 GAGGGAAAGTGGGTGGGTGAGGG - Intronic
920910962 1:210216197-210216219 GAGGGTAAGGTGAAGTGGGATGG + Intergenic
921160470 1:212468708-212468730 GAGGCTAAGGCGGTGGGGGTGGG - Intergenic
921264402 1:213410465-213410487 GAGGGGAAAGTGGTAGGGGAGGG + Intergenic
921303477 1:213772591-213772613 GAGGGGACACTGGTGGGGGGTGG - Intergenic
921960953 1:221033945-221033967 GACAGTAAGCTGGAGGTGGAGGG + Intergenic
922222517 1:223619247-223619269 GAGGATAAGCTGGAGGAGGTTGG + Intronic
922247748 1:223817247-223817269 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247756 1:223817265-223817287 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247764 1:223817283-223817305 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247772 1:223817301-223817323 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247780 1:223817319-223817341 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247788 1:223817337-223817359 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247796 1:223817355-223817377 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247804 1:223817373-223817395 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922272145 1:224043831-224043853 GAGGGGATGCTGGTGGGGAGAGG - Intergenic
922272165 1:224043887-224043909 GAGGGAGTGCTGGTGGGGGAGGG - Intergenic
923574061 1:235141997-235142019 AAGGCTAAGCTGCTAGGGGAGGG + Intronic
924577002 1:245289964-245289986 GAGGGTAGGGTGGTTTGGGAGGG - Intronic
924741037 1:246794269-246794291 GAGGTTAAGAAGGTGAGGGAAGG + Intergenic
1062922882 10:1293155-1293177 GAGGGTAAGAAGGGGGGAGAGGG + Intronic
1062983746 10:1747337-1747359 GAGGGTAAGGTGGTGAGGGATGG + Intergenic
1064461965 10:15543918-15543940 GAGGGAAAGGTGATGGGAGATGG + Intronic
1065959376 10:30722014-30722036 GATGGGCAGCAGGTGGGGGATGG + Intergenic
1066047783 10:31608800-31608822 GAAGGTGTGCTGGTGGGGAAGGG - Intergenic
1066440215 10:35431364-35431386 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1067185485 10:44023842-44023864 GAGAGCAGGCTGGTGAGGGAAGG - Intergenic
1067877491 10:50018878-50018900 GAGGGTTGGGTGCTGGGGGAGGG - Intergenic
1069368956 10:67723726-67723748 GAGGCTAAGCAGGTGTGGGCAGG - Intergenic
1069833797 10:71296367-71296389 GAGGGTGGGTAGGTGGGGGAGGG - Intronic
1070328807 10:75403982-75404004 GAGGGGAGTCAGGTGGGGGAGGG - Intergenic
1070356503 10:75645456-75645478 GAGGGTGGGTTGGTGGGGGGTGG + Intronic
1070487374 10:76943642-76943664 TAGAGTCAGCTGGTGGGAGATGG - Intronic
1071487700 10:86113730-86113752 GTGGGTGAGCTGGTGGGGCTGGG + Intronic
1071504824 10:86226322-86226344 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504831 10:86226340-86226362 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504838 10:86226358-86226380 GAGGGTGTGCTGGGGTGGGAGGG - Intronic
1071504852 10:86226398-86226420 GAGGGTGTGCTGGGGTGGGAGGG - Intronic
1071504859 10:86226416-86226438 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504866 10:86226434-86226456 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504873 10:86226452-86226474 GAGGGTGTGCTGGGGTGGGAGGG - Intronic
1071504880 10:86226470-86226492 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071504887 10:86226488-86226510 GAGGGTGTGCTGGGGTGGGAGGG - Intronic
1071504894 10:86226506-86226528 GAGGGTGTGCTGGGGCGGGAGGG - Intronic
1071504908 10:86226546-86226568 GAGGGTGTGCTGGGGTGGGAGGG - Intronic
1071504936 10:86226630-86226652 GAGGGTATGCTGGGGTGGGAGGG - Intronic
1071693751 10:87850516-87850538 AATGGAAAGCTGGTGGGGGCGGG + Intergenic
1071807683 10:89142542-89142564 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1071919692 10:90335423-90335445 GAGGGTGGGATGTTGGGGGAGGG + Intergenic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1073144648 10:101272558-101272580 GAGGGCAAGCTGGAAGGGGATGG + Intergenic
1073199523 10:101723838-101723860 GAGGGAAAGCTGGGGCAGGATGG - Intergenic
1073285109 10:102382785-102382807 GAGGGTAGGCAGGTGGGGGCTGG + Exonic
1074345461 10:112681182-112681204 GAGGCTAAGGTGGAGGTGGAAGG - Intronic
1074757469 10:116635119-116635141 CAGGGTGGGCTGGAGGGGGAAGG + Intronic
1074865414 10:117542078-117542100 GAGGGTAAGCGGGCAGGGGCTGG - Intergenic
1075227331 10:120641301-120641323 GAGGGGAAGGTGATGAGGGAGGG + Intergenic
1075609110 10:123836978-123837000 GAGGGAAAGTTAGTGGGGGGTGG - Intronic
1075775595 10:124984039-124984061 GAGGGTAGGCGGCAGGGGGAGGG + Intronic
1076059705 10:127404195-127404217 GAGGGGGAGATGGTGGGAGAGGG - Intronic
1076692441 10:132230666-132230688 GGGGGGAAGCTGGCGGGGGGGGG + Intronic
1076857393 10:133124130-133124152 GAGGGTGGGCTGGCCGGGGAGGG - Intronic
1076871725 10:133197992-133198014 GAGGGCCAGCTGCTGGGAGATGG - Intronic
1077355345 11:2114275-2114297 GAGGGTGAGGTGGTGGAGGGTGG - Intergenic
1078131091 11:8614750-8614772 CAGAGTCCGCTGGTGGGGGATGG + Exonic
1079083930 11:17432155-17432177 GGGGGTAGGGTGGAGGGGGAGGG - Intronic
1079332649 11:19546415-19546437 GAGGCTGAGCTGCTGCGGGAAGG + Intronic
1079428681 11:20367265-20367287 GAGGGAAAGCTGGGGCGGTAAGG + Exonic
1080266868 11:30410188-30410210 GAGGGTTGGATGGTGGAGGATGG - Exonic
1080405155 11:31972048-31972070 GAGGGGGAGCGGGAGGGGGAGGG + Intronic
1081605036 11:44521784-44521806 GAGGCTGAGGTGGTGGGAGAAGG - Intergenic
1081856590 11:46307987-46308009 CAGGCTCACCTGGTGGGGGATGG - Exonic
1082082478 11:48022900-48022922 GAGGGGAAGCTGGTGGGGATAGG + Intronic
1083212874 11:61199925-61199947 AAGGGAAAGCTGGTGTGGAAGGG - Intergenic
1083215817 11:61219088-61219110 AAGGGAAAGCTGGTGTGGAAGGG - Intergenic
1083218701 11:61237917-61237939 AAGGGAAAGCTGGTGTGGAAGGG - Intergenic
1083229881 11:61310097-61310119 TAGCTTAGGCTGGTGGGGGATGG - Intronic
1083427951 11:62598776-62598798 GAAGGAAAGCTGGTGGGATAAGG - Intronic
1083446887 11:62714138-62714160 GAGGGGAGGGTGGTGGGGGGGGG - Exonic
1083743280 11:64722301-64722323 GAGCGGAAGCTTGCGGGGGAAGG - Intronic
1083884634 11:65566418-65566440 GAGGGAAAGGAGGAGGGGGAGGG - Intergenic
1084195610 11:67522483-67522505 GCAGGTGAGCTGGTGGGAGAGGG + Intronic
1084729828 11:71065919-71065941 GTGGGGAAGTTGGTGGGGGCGGG + Intronic
1084729915 11:71066238-71066260 GTGGGGAAGTTGGCGGGGGAGGG + Intronic
1085689243 11:78652076-78652098 TGGGGTGGGCTGGTGGGGGAGGG + Intergenic
1085794722 11:79528559-79528581 GAGTGGAAGCTGGTGGAGGAAGG - Intergenic
1087487174 11:98770785-98770807 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1088075150 11:105839072-105839094 GAGGGAAAGCTAGAGGGGGCCGG - Intronic
1088504071 11:110512234-110512256 CAGGGTGAGTGGGTGGGGGATGG + Intergenic
1088793598 11:113248541-113248563 GAGAGTAAGCTGGGGGGTGAGGG + Intronic
1088814634 11:113412773-113412795 GAGAGTCAGCTGGTGGTGGCTGG + Exonic
1089197898 11:116705862-116705884 GAGGGAATGATGCTGGGGGAGGG + Intergenic
1089346900 11:117796715-117796737 GAGGGCAAGGGGCTGGGGGAGGG + Intronic
1089760279 11:120717869-120717891 GAGGCTGAGCAGCTGGGGGATGG + Intronic
1090083372 11:123629437-123629459 GAGGGTCAGCTGGCCTGGGATGG + Exonic
1090858473 11:130632120-130632142 GAGGATACACTGGTGGGGGTTGG - Intergenic
1091130961 11:133146966-133146988 GAGGGGAAGCTTGCAGGGGAAGG - Intronic
1091184903 11:133638368-133638390 AAGGGGAAGGTGGTGGGTGAGGG - Intergenic
1091238861 11:134039291-134039313 GGGGTGAGGCTGGTGGGGGAGGG - Intergenic
1091543111 12:1480714-1480736 GAAGATAAGCAGGTGTGGGAGGG + Intronic
1091615719 12:2050177-2050199 GTGGGTGAGCTGGTGGGGGCAGG - Intronic
1091930851 12:4394174-4394196 TGGGTGAAGCTGGTGGGGGAAGG - Intergenic
1096840856 12:54378708-54378730 AGGTGCAAGCTGGTGGGGGAGGG + Intronic
1097088781 12:56488603-56488625 GAGGCGAAGCCGGTGGGGGCGGG + Intergenic
1097143110 12:56919728-56919750 GAGGGTAAGGGGCTAGGGGAGGG + Intergenic
1097167948 12:57095519-57095541 GAAGGGAAGCTGGCGGTGGATGG + Exonic
1097816541 12:64080675-64080697 GGGGGTCAGCAGGTAGGGGAGGG - Intronic
1098101214 12:67018883-67018905 GAGAGGAAGAGGGTGGGGGAAGG - Intergenic
1099133293 12:78863586-78863608 AAGGCTCAGCGGGTGGGGGAAGG - Intergenic
1100406890 12:94279730-94279752 GAATGGAAGCTGGTGGGGGCAGG - Intronic
1100444042 12:94644500-94644522 GCGGGTGAGCTGGTGGTGGCCGG + Intronic
1101771286 12:107753960-107753982 GAGGGTAAGGTGGTGGAGGTAGG + Exonic
1101849476 12:108390796-108390818 GCTGGGAAGTTGGTGGGGGATGG + Intergenic
1102036815 12:109775308-109775330 GAGGGTACGAGGGTGGGGGTGGG + Intergenic
1102175199 12:110868749-110868771 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1102784594 12:115594224-115594246 GGGGGTAACATGGCGGGGGAGGG + Intergenic
1102887688 12:116534134-116534156 GGGGGGAGGCAGGTGGGGGAGGG - Intergenic
1103134972 12:118499363-118499385 GAGGGGAAGCGGGGAGGGGAGGG - Intergenic
1103260979 12:119588366-119588388 GAGGGGCAGGGGGTGGGGGAGGG - Intergenic
1104047562 12:125173867-125173889 GGGGGTGGGCTGGTGGGGGAAGG + Intergenic
1104811496 12:131622617-131622639 GAGGGCAAGGTGGCGGGGGTGGG - Intergenic
1105073452 12:133252747-133252769 GAAGGCAAGCTGGTGGGGTGAGG - Intergenic
1105855865 13:24371346-24371368 GAGGGTGAGCTGATGAAGGAGGG + Intergenic
1106423225 13:29601270-29601292 CAGGAGAAACTGGTGGGGGAGGG + Intergenic
1106880291 13:34121847-34121869 GATAATAAGCTGGTGGTGGATGG + Intergenic
1107679540 13:42834245-42834267 GAGGGGAAGCTGATTTGGGAGGG - Intergenic
1107995632 13:45857604-45857626 GTGGTTCAGTTGGTGGGGGATGG - Intergenic
1108492369 13:50994222-50994244 GAGGGGAAGGCGGAGGGGGAGGG - Intergenic
1108663660 13:52608201-52608223 GATGGCAAGGAGGTGGGGGAAGG + Intergenic
1110253868 13:73410083-73410105 GAGGGTAAGGTGGACGGGGCTGG + Intergenic
1111125279 13:83906661-83906683 GAGGGTAGGGACGTGGGGGACGG + Intergenic
1112156719 13:96825155-96825177 AGGGTTAAGCTGGTGGTGGAAGG + Intronic
1112332211 13:98485278-98485300 AAGGATAAGCTGGTGGGGTAGGG + Intronic
1113430473 13:110245916-110245938 AAGCGTAAGGTGGTGGGGGAAGG - Intronic
1113693808 13:112330256-112330278 GAGGGTGAGCGGGTGGTGGGAGG - Intergenic
1113695894 13:112345201-112345223 GAGGGCAGGGTGGTGGGGGGCGG - Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115239411 14:31240124-31240146 GATGGTCACCTGGTGGGGGTTGG + Intergenic
1116781283 14:49240603-49240625 CAGGGTAGGTTGGTGGGGGCAGG + Intergenic
1117487678 14:56214254-56214276 GAGGGAAGGTTGATGGGGGAGGG + Intronic
1117667851 14:58076094-58076116 GAGGGGAAGGGGGAGGGGGAAGG + Intronic
1117673389 14:58130951-58130973 GAGATTAAGATGGTGGGGGGTGG - Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1118921942 14:70157380-70157402 GAGGGGAAGAGGGTGGGAGAAGG + Intronic
1119145576 14:72310745-72310767 CAGGGGAGGCTGGTGGTGGAAGG - Intronic
1119653265 14:76398579-76398601 GAGGGTAGGGCTGTGGGGGAAGG + Intronic
1119929568 14:78531840-78531862 GAGGTAAAGCTTTTGGGGGAAGG + Intronic
1119932008 14:78556901-78556923 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1120936741 14:89904118-89904140 GGGGGTAGGGTGCTGGGGGAGGG - Intronic
1121079421 14:91095780-91095802 GACGGAAAGCTGGGGAGGGAGGG - Intronic
1121156623 14:91691162-91691184 GAGAGTAAGGTGGTGGGGTCTGG - Intronic
1121457087 14:94045305-94045327 GAGGCTAGGCTGGTGAGTGAGGG - Intronic
1121573087 14:94962129-94962151 GAGGCTGAGCTGGGTGGGGAGGG + Intergenic
1121618850 14:95332300-95332322 GAGGGGAAGCTGCTGGGAGTGGG + Intergenic
1121656269 14:95598067-95598089 GAGGGCAAGCTGGTGAGGTCAGG + Intergenic
1122907514 14:104808567-104808589 GAGGGAAAGTGGGAGGGGGAGGG - Intergenic
1122915576 14:104856853-104856875 GGGGGTCAGCTGTTGGGGGGAGG + Intergenic
1123108795 14:105855656-105855678 GAGGGGAAGCAGGTGGGGTCTGG - Intergenic
1124448674 15:29764283-29764305 AAGGGTATGTTTGTGGGGGAGGG + Intronic
1124634250 15:31354793-31354815 GAGAGGACGGTGGTGGGGGAGGG - Intronic
1125353983 15:38797616-38797638 GAGGGTGAGGGGCTGGGGGAGGG - Intergenic
1125510627 15:40290726-40290748 GAGGCGAAGCAGGTGTGGGAGGG + Intronic
1125672054 15:41480865-41480887 GAGGGGAGGCTGGTGGGAGATGG - Exonic
1125767273 15:42144107-42144129 GGGGGTGAGCTGGTTGGGGAAGG + Exonic
1125793353 15:42386472-42386494 TAGTGGAAGGTGGTGGGGGAGGG - Intronic
1126500648 15:49340410-49340432 GAGGCAAAGCGGGGGGGGGAGGG - Intronic
1127222263 15:56892088-56892110 GTGTGTGAGCTGGTGGTGGAGGG + Intronic
1127934489 15:63623777-63623799 AAGGTTAAGCTGGTTGGAGAAGG - Exonic
1128733597 15:70036954-70036976 GAGGGTCAGCAGGTGGAGGGAGG - Intergenic
1129161806 15:73751943-73751965 GGGGGGAAGGTGGGGGGGGAGGG - Intronic
1129196314 15:73969307-73969329 GCGGGAAAGGAGGTGGGGGAAGG + Intergenic
1129247224 15:74286894-74286916 GAGGGGAAGAGGGAGGGGGAAGG - Intronic
1130428553 15:83823208-83823230 GAGGGTGAGGGGGAGGGGGAGGG + Intronic
1130602154 15:85283491-85283513 GAGGGTAAGGAGGAGTGGGAGGG + Intergenic
1131430811 15:92387582-92387604 GAGGGAAAGATGGAGGGGGGTGG - Intergenic
1131441190 15:92460945-92460967 GAGGGTAAGATGCTGAGAGAGGG + Intronic
1132092996 15:98960783-98960805 GAGGGCAGCCTGGAGGGGGAGGG - Exonic
1132240395 15:100253355-100253377 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240403 15:100253373-100253395 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240411 15:100253391-100253413 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240419 15:100253409-100253431 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240427 15:100253427-100253449 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240435 15:100253445-100253467 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132240443 15:100253463-100253485 GAGGGGAAGGTAGAGGGGGAGGG + Intronic
1132401479 15:101510062-101510084 GAGGATAGGATGGTGGGGGATGG - Intronic
1132581287 16:685850-685872 GAGGGTAGGCTGGGGTGGGTAGG - Exonic
1132599226 16:766599-766621 GAGGTTATGCTGGTGGTGGAGGG + Intronic
1132659618 16:1055522-1055544 GAGGGCCAGCTGGGGAGGGAAGG + Intergenic
1132920947 16:2392266-2392288 GAGGAGAAGCTGGTAGGGGAGGG - Intergenic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1132998878 16:2839164-2839186 GCGGGCAGGGTGGTGGGGGAAGG + Intronic
1133032471 16:3017888-3017910 GAGGCAAGGCAGGTGGGGGAGGG + Intronic
1133842738 16:9424915-9424937 GAGGGAGAGAAGGTGGGGGAGGG + Intergenic
1134222033 16:12362565-12362587 GAGGAGAAACTGGTGGGGGGGGG - Intronic
1135510462 16:23078503-23078525 GAGGGTCAGCTGTCGGGGAAAGG - Intronic
1137555554 16:49468187-49468209 TAGGTTGAGCTGATGGGGGAAGG + Intergenic
1137556998 16:49477140-49477162 GAGGGTGAGCGGAAGGGGGAGGG + Intergenic
1138112560 16:54336571-54336593 GAGGGCAGGAAGGTGGGGGAGGG + Intergenic
1138418227 16:56883736-56883758 GGGGGTGAGATGGAGGGGGAAGG - Intronic
1138482581 16:57313327-57313349 GAGGGGAGGCTGGTGGGGATGGG + Intergenic
1138607697 16:58099442-58099464 GAGGCTGGGCTGCTGGGGGAGGG - Intergenic
1140045649 16:71439005-71439027 GATGGAAAGGTGGTGGGGAAGGG - Intergenic
1141173332 16:81704446-81704468 GAGGGTAAGTGGGTAGGGGAGGG - Intronic
1141906820 16:87032225-87032247 GGGTGTGAGCTGGTGGGAGAGGG - Intergenic
1141970858 16:87481553-87481575 AAGGGTAAGCGGGAGGGGAAAGG + Intronic
1141973050 16:87495748-87495770 GAGGGTCGGGGGGTGGGGGAGGG - Intergenic
1142027874 16:87824170-87824192 GATGGTGAGATGGTGGGGGGAGG - Intergenic
1142098399 16:88258416-88258438 GGGGGTAAGCTGGGGGGGTGGGG - Intergenic
1142175308 16:88642507-88642529 GAGTGTTGGCTGGTGGGGGGTGG + Intergenic
1142226826 16:88881609-88881631 GAGAGTAAGGGGGTGAGGGAGGG + Intronic
1142247476 16:88976623-88976645 GAGGGGAAGGTGGTGGGGTGGGG - Intronic
1142284983 16:89167981-89168003 GAGGGGCTGCTGGTGGGGGCGGG - Intergenic
1142352246 16:89585817-89585839 GAGGGTCAGGTGGGGGTGGAGGG + Intronic
1142429116 16:90016917-90016939 GAGAGGAAGGTGCTGGGGGATGG - Intronic
1142641550 17:1288515-1288537 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641602 17:1288641-1288663 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641670 17:1288786-1288808 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641925 17:1289353-1289375 ATGGGGAACCTGGTGGGGGATGG - Intronic
1143807986 17:9445491-9445513 GAGGGGGGGATGGTGGGGGAGGG + Intronic
1143836998 17:9700664-9700686 GAGGGTAAGCAGTTGCTGGAGGG + Intronic
1144715619 17:17433579-17433601 GGGCAAAAGCTGGTGGGGGAGGG - Intergenic
1144825601 17:18104052-18104074 GAGGGTACCCTGGTGGGGCAAGG + Intronic
1146809324 17:35890734-35890756 GAGGGGGAGGGGGTGGGGGAAGG - Intergenic
1146944862 17:36866736-36866758 GAGGGTGAGCTGGGAGGGGCAGG + Intergenic
1147134929 17:38428963-38428985 GAGGGAGAGGGGGTGGGGGAGGG + Intronic
1147384966 17:40075654-40075676 GAGGGGAAGGTGATGGGGGAGGG - Intronic
1147427399 17:40352458-40352480 GAGGGTGATCTGGTCGGCGATGG - Exonic
1147575193 17:41594892-41594914 GTGGGTAGGCAGGTGGGTGAAGG + Intergenic
1148404091 17:47397030-47397052 GAGGGAAAGGGGGAGGGGGAGGG - Intronic
1148675347 17:49441663-49441685 GAGAGGAAGGTGGAGGGGGAGGG + Intronic
1148744727 17:49911895-49911917 GAGGGTGGGATGGTGGGGGCAGG - Intergenic
1148774499 17:50088000-50088022 GACTGTAAGCTGGTGGTAGAAGG - Intronic
1148818678 17:50347658-50347680 GAGGAGGAGGTGGTGGGGGATGG - Intronic
1148852538 17:50561812-50561834 GAGGGTAGGCGGATGGGGGGGGG + Intronic
1149195171 17:54110792-54110814 GAGGGGGAGGTGGAGGGGGAGGG + Intergenic
1149424971 17:56546018-56546040 GAGGGGAGGAGGGTGGGGGAGGG + Intergenic
1149446832 17:56719869-56719891 GAGGAGAAGCTGGTGGCCGATGG + Intergenic
1149548890 17:57525227-57525249 TTAGGTAAGCTGGTGGGGAATGG - Intronic
1149688047 17:58549781-58549803 CAGGGTAAGCTGTTGGTGGAAGG + Intergenic
1150276389 17:63900516-63900538 GAAGGAAAGCTGTTGGGTGAAGG + Intergenic
1150315691 17:64166884-64166906 GAGGCCAGTCTGGTGGGGGAAGG + Intronic
1150638310 17:66932084-66932106 CAGGGTGAGCTGGTGAAGGAAGG - Intergenic
1151122520 17:71808580-71808602 GAGTGTGTGCTGGTGGGGGAAGG - Intergenic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1151351417 17:73534273-73534295 GCGGGTCCGCTGCTGGGGGAAGG + Intronic
1151699874 17:75737441-75737463 AAGGGTGAGCTGGTGGGGCCGGG + Exonic
1151911257 17:77084855-77084877 GAGAGGAAGCAGGTGGGGGCAGG - Intergenic
1152045217 17:77930772-77930794 GAGGGGGAGCTTGTGGGGCAGGG - Intergenic
1152045950 17:77935764-77935786 GAGGGGGAGGTGGTGGGGGGTGG + Intergenic
1152217974 17:79045454-79045476 GAGGATGAGCTGGTGCGGGGAGG + Intronic
1152236454 17:79141549-79141571 GAGGGTCAGGTGGTTGGGGTGGG + Intronic
1152277158 17:79364609-79364631 GAGGGTGTGCTGGTGGGTGACGG + Intronic
1152301053 17:79495504-79495526 GAGGGTGGGGAGGTGGGGGAGGG + Intronic
1152307092 17:79527503-79527525 GAGACAAAGCTGGTGGGGGAGGG - Intergenic
1152309007 17:79537874-79537896 GAGGATGAGCTGATGGGGGTGGG + Intergenic
1152604121 17:81280544-81280566 GAGGGCGAGCTGCTGGGAGACGG - Intronic
1153700821 18:7691967-7691989 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700830 18:7692001-7692023 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700839 18:7692035-7692057 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700848 18:7692069-7692091 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700857 18:7692103-7692125 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700866 18:7692137-7692159 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700875 18:7692171-7692193 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700884 18:7692205-7692227 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700893 18:7692239-7692261 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700902 18:7692273-7692295 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700911 18:7692307-7692329 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700920 18:7692341-7692363 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700929 18:7692375-7692397 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153715216 18:7840095-7840117 GAGGGCAGGGTGATGGGGGAGGG + Intronic
1154078191 18:11225810-11225832 GAGTGTGAGCAGGTGGGGGAAGG - Intergenic
1154217066 18:12423186-12423208 GAGGGGAAGGTGGTGTGGGAGGG + Intronic
1154376272 18:13812454-13812476 GTGGGTGGGCTGGTGGGGGTCGG + Intergenic
1156457879 18:37304880-37304902 GAGGGGGAGCAGGTGGGGGCTGG + Intronic
1156475149 18:37401244-37401266 GAGGATGACCTGGTGGGAGAAGG - Intronic
1156872343 18:41960588-41960610 GAGGGTTAGCGGATGGGGTAGGG + Intronic
1158114789 18:53983226-53983248 CTGGGAAGGCTGGTGGGGGATGG + Intergenic
1158519791 18:58162334-58162356 GGGGGGAAGCTGGTGAAGGATGG - Intronic
1158790482 18:60774709-60774731 GAGTGTGTGCTGGTGGGGGAAGG - Intergenic
1159684054 18:71394532-71394554 GAGGGTGAGGTGGTGGGAGGAGG - Intergenic
1159966358 18:74598806-74598828 GAGTTTAAGCTGGTGGAGGCGGG + Intronic
1160696025 19:484912-484934 GAGGGTAGGAAGGTGGGGGTAGG + Intergenic
1160699353 19:498496-498518 GACGGTCAGCTGGTCCGGGAAGG - Exonic
1160783881 19:890934-890956 GAGGGGAAGCAGGTGGGAGGGGG + Intronic
1160966602 19:1749510-1749532 GAGGCCAAGCTGCTGAGGGAGGG + Intergenic
1161271910 19:3394521-3394543 TAGTGTAAGCGGGTGGGGGGTGG - Intronic
1161520983 19:4723471-4723493 GAGGGAAAGAAGGTGGAGGAGGG + Intronic
1161713974 19:5865250-5865272 AAGGGGAACCTGGTGGTGGAAGG - Intergenic
1161925233 19:7294458-7294480 GAGGGAAAGCTTGCAGGGGAGGG + Intergenic
1162327063 19:10005807-10005829 GAGGTTGACCTGCTGGGGGAGGG + Exonic
1162725809 19:12689259-12689281 GAGGGCAACCTGGTGGTGGCCGG - Exonic
1164390305 19:27814034-27814056 CATGGGAAGCTGTTGGGGGATGG - Intergenic
1164394596 19:27851738-27851760 GAGGAGCAGCTGGTGGGTGAAGG - Intergenic
1164787201 19:30942984-30943006 AAGGGAAAGCTGGTGGGTGTTGG - Intergenic
1165331233 19:35142218-35142240 GATGTGAAGTTGGTGGGGGAGGG - Intronic
1165347700 19:35259143-35259165 GAGGGTAAGCTGGAGGGCAGAGG - Intronic
1165859205 19:38898414-38898436 GAGGGTGAGAGGCTGGGGGAGGG + Exonic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166631281 19:44410133-44410155 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
1166632161 19:44416247-44416269 GGGGGTGAGCTGCTGGGTGACGG - Intergenic
1166636889 19:44458461-44458483 GCGGGTGAGCTGCTGGGTGATGG + Intergenic
1167148602 19:47696381-47696403 GAGGGGAAGCTGGTCGGGGGAGG + Intronic
1167285337 19:48596062-48596084 GGGGATGAGCTGGAGGGGGATGG + Intronic
1167289519 19:48616707-48616729 GAAGGTGAGCTGGCGGGGGCTGG - Exonic
1167322627 19:48806048-48806070 GGGGGGGAGATGGTGGGGGAGGG - Intronic
1168105035 19:54161252-54161274 GAGGGTAAGCTGGTGGGGGAAGG + Exonic
1168449978 19:56458767-56458789 GAGGGTAAGTTATGGGGGGAGGG - Intronic
1202649295 1_KI270706v1_random:166107-166129 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
926163116 2:10501934-10501956 GAGGAAAGGCTGGTGGAGGAGGG - Intergenic
926306665 2:11642017-11642039 GAGGGTAGGCAAGTGGGAGAAGG - Exonic
926349885 2:11984869-11984891 GAGAGTAAGCTGGAGAGGTAAGG + Intergenic
926506446 2:13721873-13721895 GATGGGGAGCTGGAGGGGGATGG - Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
927562098 2:24081171-24081193 GGGGGTGGGCTGGTGGGGGTGGG + Intronic
927799329 2:26083435-26083457 GAGGGGAAGGTTTTGGGGGAGGG - Intronic
927846841 2:26476501-26476523 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846853 2:26476525-26476547 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846865 2:26476549-26476571 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846889 2:26476597-26476619 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846908 2:26476633-26476655 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846934 2:26476681-26476703 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
927846953 2:26476717-26476739 GTGGGGAAGGAGGTGGGGGAAGG - Intronic
928077017 2:28274155-28274177 GAGAGAAAGCTGGATGGGGAAGG - Intronic
928295472 2:30079232-30079254 GAGGCTCAGCTGGTGGGTGCTGG - Intergenic
928788157 2:34915680-34915702 AAGGGTAAGCTGGTGGTGTTAGG - Intergenic
929030981 2:37649637-37649659 GTCGGTAGGCTGGTGGGGGCTGG + Intronic
929860331 2:45671583-45671605 GAGAGAAGGCTGGTGGGGGGAGG - Intronic
929899331 2:45987594-45987616 GTGGGGATGCTGGTGGGGGGAGG - Intronic
930033731 2:47073063-47073085 GAGAGTCAGATGGCGGGGGATGG - Intronic
930223727 2:48770897-48770919 GAAGCTTAGCTGGTGGAGGATGG + Intronic
930297059 2:49568055-49568077 GATGGTGGGGTGGTGGGGGATGG + Intergenic
930872839 2:56184985-56185007 GAGGGTCACCTGTTGAGGGAGGG - Intronic
932421164 2:71602333-71602355 GAGGGAGAGCTGGAGGGGCAGGG - Intronic
932528056 2:72494331-72494353 GAGGCCAGGCAGGTGGGGGATGG + Intronic
932752112 2:74377865-74377887 GAGTGGAAGGTAGTGGGGGAGGG - Intronic
932815744 2:74860192-74860214 GAGGGTAGGAGGGTGGGGGGTGG + Intronic
933768512 2:85728110-85728132 GAGGGTGAGGTGTTTGGGGAAGG + Intergenic
933830065 2:86199573-86199595 AAGGGGAAACTGGTGCGGGATGG + Intronic
934101840 2:88660605-88660627 GTGTGTATGCAGGTGGGGGAGGG + Intergenic
934563948 2:95328158-95328180 CTGGGGAAGCTGGTGGGGGCTGG - Intronic
934660575 2:96141469-96141491 GAGGGTGTGCTTGTGGGGCAGGG - Intergenic
934886621 2:98030879-98030901 GATGATAGGATGGTGGGGGACGG - Intergenic
935505193 2:103891609-103891631 GAAGTCAAGCAGGTGGGGGAGGG + Intergenic
936435544 2:112502149-112502171 AAGGGTAAGTTGGAGAGGGAGGG - Intronic
937819331 2:126290074-126290096 GAGGGTAAGGTGTGGGGGGCAGG - Intergenic
937919998 2:127122214-127122236 GAGGGCAGGTTGGAGGGGGAAGG - Intergenic
938267920 2:129942509-129942531 GGGGGTGAGGTGCTGGGGGAGGG - Intergenic
938384110 2:130852515-130852537 GACTGTGAGCTGGTGGGGGTGGG + Intronic
938540870 2:132282462-132282484 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
938541690 2:132288365-132288387 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
938965464 2:136384416-136384438 GAGGGAATGCTGGTGGGAGTGGG + Intergenic
938973393 2:136452627-136452649 AAGGGTAATTTGGTGGGTGAAGG + Intergenic
939019314 2:136940157-136940179 GAGGGTAGGTTGGGGGGTGAGGG - Intronic
939177953 2:138772040-138772062 GAGGACAAGCAGGTGGGTGAGGG - Intronic
941099619 2:161281887-161281909 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
941110846 2:161417463-161417485 GCGGGTGAGCTGGAGTGGGAAGG - Intronic
942201264 2:173573767-173573789 GAGGGTGAGAGGGTGGGAGAAGG - Intergenic
942247845 2:174023984-174024006 GGAGGCAAACTGGTGGGGGAGGG - Intergenic
943029667 2:182670820-182670842 GAGGGGAGGCGGGTGGTGGATGG + Intergenic
944290280 2:197996976-197996998 GAGGGTGAGGTGGCGGGAGAGGG + Intronic
944688893 2:202141369-202141391 GGGGGTGAGGTGGTGGGGGCAGG + Intronic
945453204 2:210017414-210017436 GTGGGTATGTTGGTGGGGGTGGG - Intronic
945467602 2:210187312-210187334 GAGGGTAGGGGGGTAGGGGAGGG + Intergenic
946324926 2:218980428-218980450 GAGGGGAGGGTGGTTGGGGAAGG + Intergenic
946923851 2:224606241-224606263 CAGGGTAAGCTGGCCGGGCATGG - Intergenic
947383790 2:229570773-229570795 GAGGCAAAGCAGGTGGGGGAGGG + Intronic
947628783 2:231638081-231638103 GGCAGTAAACTGGTGGGGGAGGG - Intergenic
947865931 2:233397732-233397754 GAGGGTGAACTGGAAGGGGAGGG + Intronic
947988215 2:234466643-234466665 GAGGCTCCGCTGATGGGGGAGGG + Intergenic
948209369 2:236181012-236181034 GAGAGTAGGTTGGTGGGAGAGGG + Intergenic
948420641 2:237858356-237858378 AGGGGTGAGATGGTGGGGGAGGG - Intergenic
948510601 2:238461681-238461703 AGGGGTGGGCTGGTGGGGGAGGG + Intergenic
948771148 2:240251823-240251845 GAGGGAGAGCTGGGGCGGGAAGG - Intergenic
948891981 2:240911667-240911689 GAGAGTAGGATGGTGGGGGCTGG - Intergenic
948901413 2:240958561-240958583 GGGGGGCGGCTGGTGGGGGATGG - Intronic
949019196 2:241731573-241731595 GAGGCTGAGATGCTGGGGGAAGG + Intergenic
949019211 2:241731639-241731661 GAGGCTGAGATGCTGGGGGAAGG + Intergenic
1169046111 20:2535820-2535842 GAGGAAAAGCTGCTGAGGGAGGG + Intergenic
1169801793 20:9518225-9518247 GAAGGTAAGTTGTTGGGGGATGG + Exonic
1170812318 20:19684227-19684249 GAAGGAAAGCTGGTGTGGGTAGG - Exonic
1171009222 20:21498914-21498936 AAAGGGCAGCTGGTGGGGGAGGG + Intergenic
1171391991 20:24807497-24807519 AAGGGTGAGCTGGTGTGAGATGG - Intergenic
1171768390 20:29302153-29302175 AGGGATAAGCTGGGGGGGGAAGG + Intergenic
1172037492 20:32019978-32020000 GAGGGGAAGACGGAGGGGGAAGG - Intronic
1172127913 20:32636137-32636159 GATGGTGAGCTGCTGGGGGAAGG + Intergenic
1172442780 20:34977722-34977744 GAGGGTGGGCGGGTGGGTGAGGG + Intronic
1173202072 20:40961560-40961582 GAGGGTCAGTTGGTGGGTGTGGG - Intergenic
1173438081 20:43050460-43050482 GAGGGAGAGCTGGTGGTAGATGG - Intronic
1173666349 20:44766067-44766089 GAGGGCACTGTGGTGGGGGAGGG + Intronic
1173875714 20:46369862-46369884 AAGGAAAAGATGGTGGGGGATGG + Intronic
1174205737 20:48837015-48837037 TAAGGTTAGATGGTGGGGGAAGG - Intergenic
1174442338 20:50566165-50566187 TAGGGGAGGCTGATGGGGGAGGG + Intronic
1175114661 20:56673662-56673684 GAGAGAATGCTAGTGGGGGATGG + Intergenic
1175120220 20:56710994-56711016 GAGGGAGAGGAGGTGGGGGAAGG - Intergenic
1175757552 20:61539072-61539094 GCGGGTCAGGTGGAGGGGGAAGG + Intronic
1175840825 20:62026161-62026183 GAGGCAGGGCTGGTGGGGGAAGG - Intronic
1175891308 20:62317262-62317284 GAGGGCCAGCTGGTCTGGGAAGG - Intronic
1176090554 20:63316530-63316552 CTGGGGAAGATGGTGGGGGAAGG - Intronic
1176109150 20:63403307-63403329 GAGTGTAAGCTGCCTGGGGAGGG - Intergenic
1176145174 20:63562256-63562278 GAGGGGAAGCTGGAGGGGTGGGG + Intronic
1176239014 20:64067392-64067414 GAGGGGAAGCGGGAGGGAGAAGG + Intronic
1176312189 21:5157980-5158002 TAGGGGAGGCGGGTGGGGGAGGG - Intergenic
1176602855 21:8809060-8809082 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
1176931017 21:14810199-14810221 GAGGGGAAGCTGGTGAGCCAGGG - Intergenic
1177457958 21:21368437-21368459 CAGACTAAGATGGTGGGGGAGGG - Intronic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1179403120 21:41102566-41102588 GAGGGGACACTGGTGAGGGAAGG + Intergenic
1179452366 21:41475043-41475065 GTGGGTGAGGTGGTGGGTGAGGG + Intronic
1179551287 21:42145586-42145608 GAGGGTCTGATGGCGGGGGAGGG + Intergenic
1179674954 21:42974840-42974862 GAGGGGGCGCGGGTGGGGGAGGG + Intronic
1179844859 21:44104050-44104072 TAGGGGAGGCGGGTGGGGGAGGG + Exonic
1179908177 21:44434902-44434924 CGGGGTCACCTGGTGGGGGAAGG - Intronic
1180094469 21:45549666-45549688 GGGGGACAGGTGGTGGGGGAGGG + Intergenic
1180094494 21:45549718-45549740 GGGGGATAGGTGGTGGGGGAGGG + Intergenic
1180305112 22:11067377-11067399 GGGGCTAAGCTTGTGGTGGAGGG + Intergenic
1180344811 22:11697992-11698014 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
1180345140 22:11700617-11700639 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
1180352914 22:11818860-11818882 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
1180385326 22:12173497-12173519 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
1180655039 22:17413141-17413163 GAGGGTTATCTGATGGGGAATGG + Intronic
1180984608 22:19897035-19897057 GAGGGTGAGCTGGCAGTGGACGG - Intronic
1181545651 22:23600628-23600650 GAGGGGAGGCTAGTGGGGGTGGG - Intergenic
1181652884 22:24270710-24270732 GAGGGGGTGGTGGTGGGGGACGG + Intergenic
1181673638 22:24437915-24437937 GAGGTGAAGCTGCTGGGGAAGGG - Intronic
1181814659 22:25429270-25429292 GAGGGGAAGCTGGTGGGGGTGGG + Intergenic
1181836541 22:25614921-25614943 CAGGGTGAGCTGGTTAGGGATGG - Intronic
1182034836 22:27189786-27189808 GAGGCTATGTTGGTGGGTGAGGG - Intergenic
1182844835 22:33421834-33421856 GGGGGTAAGCAGGTGGAAGAGGG + Intronic
1182886395 22:33777636-33777658 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1182934775 22:34210630-34210652 TGGGCAAAGCTGGTGGGGGATGG + Intergenic
1183041485 22:35182176-35182198 GAGGGTAGGGTGCTAGGGGAGGG + Intergenic
1183380078 22:37486231-37486253 GAGGGGAAGCTGGTCAGGCAGGG + Exonic
1183492738 22:38125375-38125397 GAGGGAATGCTGATGGGGCAGGG + Intronic
1183582068 22:38732010-38732032 GAGGGTAGGCTGGTGGGTGGGGG + Exonic
1183718129 22:39546212-39546234 GAGGGAGAGGTGGTAGGGGAAGG - Intergenic
1183929912 22:41230004-41230026 GAAGGGAAGCTGGAGGGTGAAGG + Intronic
1184319917 22:43733417-43733439 GAGAGTAGGCTGGAGGGAGATGG + Intronic
1185327934 22:50236643-50236665 GAGGGTGGGCTGGAGGGGGCAGG + Intronic
949970889 3:9403048-9403070 GAGGCAATGTTGGTGGGGGAGGG + Intronic
950044443 3:9940716-9940738 GAGGGAAAGGGGGAGGGGGAGGG + Intronic
950502665 3:13374297-13374319 GAGGATAAGCTGGTGGGAGTAGG - Intronic
950842819 3:15983712-15983734 GAGGTGAGGGTGGTGGGGGAAGG + Intergenic
950969105 3:17168650-17168672 GAGGATGTGCTGGTGGAGGAAGG + Intronic
951798567 3:26569621-26569643 GAGGATAGGTTGGTGGGGAAAGG + Intergenic
952794031 3:37223200-37223222 GGGGGTAAGCAGGAGGGGGTTGG + Intergenic
953422154 3:42762463-42762485 CAGGGTAGGCTGGAGGGGGCTGG + Intronic
953702970 3:45210828-45210850 GAGGGTAAAGTGGATGGGGAGGG + Intergenic
953798327 3:46002346-46002368 GAGGGCAACCTGGAGGGGGCTGG - Intergenic
953975652 3:47380338-47380360 GTGGGGAAGTGGGTGGGGGAAGG - Intergenic
955402623 3:58604032-58604054 GAGGGGCATCTGGTGGGGCAGGG - Intronic
955407082 3:58632404-58632426 GAGGGTGAGCTGGGGTGGGTTGG + Intergenic
955534356 3:59907399-59907421 AAGGCTAAGCTGGTGAGTGAAGG - Intronic
955848295 3:63192298-63192320 GAGGGTGGGTGGGTGGGGGAGGG - Intergenic
956740105 3:72269102-72269124 GAGGGTGAGCAGGTGGGAGTAGG - Intergenic
957335182 3:78818594-78818616 GAGGCTGAACTGGTGGGGCAAGG + Intronic
958883348 3:99697957-99697979 GTGGGTGAGGGGGTGGGGGAGGG - Intronic
959330365 3:104997003-104997025 GAGGGTAGGGTGGTGGAGGTCGG - Intergenic
959564525 3:107820767-107820789 TAGGGAAAGTTGGTGGGGGGAGG + Intergenic
959991794 3:112639025-112639047 GAGGGCCAGGTGGTGGCGGAGGG - Exonic
960034228 3:113086679-113086701 GAGGCTCAGCTGATGGGGCATGG + Intergenic
960673074 3:120170547-120170569 GAGGAGAGGCTGGTGGAGGAGGG - Intronic
960944845 3:122958785-122958807 GAGGGCAAGGGGGTGGGGGTAGG - Intronic
961377649 3:126476996-126477018 GAGGGCAAACAGGTAGGGGAGGG - Intergenic
961559699 3:127720145-127720167 TAGGGTAAGCCTGTGGGTGACGG + Intronic
962187050 3:133271123-133271145 GAGGGCATGGTGTTGGGGGAAGG - Intronic
962405238 3:135094659-135094681 GAGGGAAAGCAGGAGGGAGAAGG - Intronic
962894731 3:139704151-139704173 GTGGGTAAGGTGGGGGAGGAGGG + Intergenic
962922151 3:139959919-139959941 GAGAATAAGCTGGTAGGGGGTGG - Intronic
963120381 3:141771455-141771477 GAGGGTAAGAAGGTGGGAGCAGG + Intergenic
963120396 3:141771540-141771562 GAGGGTAAGAAGGTGGGAGCAGG + Intergenic
963847811 3:150177765-150177787 CAGGGTTAGCTGGTGGGGTGTGG + Intergenic
964561773 3:158004829-158004851 GTGGGTAGGCGGGTAGGGGAGGG + Intergenic
964687319 3:159411129-159411151 AAGGGTATTGTGGTGGGGGAGGG + Intronic
965760781 3:172073920-172073942 AAGGGTCATGTGGTGGGGGAAGG - Intronic
966026291 3:175286966-175286988 GAGGGTATGGTGGGGGTGGAGGG + Intronic
966881780 3:184354726-184354748 GAGGGTCAGAGGGTGAGGGAGGG + Intronic
966917879 3:184594738-184594760 GGGAGTGAGCTGGAGGGGGATGG + Intronic
966929021 3:184663832-184663854 GAGGGCAAGCTGGTCAGAGAGGG + Intronic
967467755 3:189827349-189827371 AAGGGGGAGCTGGTGGGGGGTGG - Intronic
968339312 3:197941467-197941489 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
968466552 4:754438-754460 GAGGGTTGGCTGGTGGGGAGCGG + Intronic
968626192 4:1627737-1627759 GAGGGCAAGGGGGTGGTGGAGGG - Intronic
968915946 4:3497139-3497161 GAGGGCAGGCTGCTGGAGGATGG + Intronic
969088849 4:4677336-4677358 GAAGGTAAGGAGGAGGGGGAAGG - Intergenic
969394538 4:6911504-6911526 GAGGGTAGGCTGGGGGCAGACGG - Intronic
969536831 4:7761474-7761496 GTGAGGAAGCTGGTGGGTGACGG + Exonic
969840954 4:9881454-9881476 GAGGGCTAGCTGGTGAGGTAGGG - Intronic
970146141 4:13038114-13038136 GAGAGAAGGCTGGTGGGTGAGGG - Intergenic
971327910 4:25658917-25658939 GAGGGGAGGGTGGTGGGGGTGGG - Intronic
972168230 4:36312977-36312999 GAGGTAGAGCTGGTGGGGAATGG + Intronic
972247275 4:37258662-37258684 GAGTGTCAGCAGGTGGAGGAAGG + Intronic
973375174 4:49281300-49281322 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
973376074 4:49287322-49287344 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
973376997 4:49293485-49293507 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
973377917 4:49299640-49299662 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
973378860 4:49305920-49305942 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
973379358 4:49309734-49309756 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
973380230 4:49315730-49315752 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
973381149 4:49321896-49321918 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
973382237 4:49328941-49328963 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
973385772 4:49513553-49513575 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
973639782 4:52891386-52891408 GAGGAAAATCAGGTGGGGGAGGG + Intronic
974180434 4:58378088-58378110 GATGGTAAGTTGGGGGGGCAGGG - Intergenic
974597688 4:64036622-64036644 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
975139341 4:70903385-70903407 GAGGGGAACGTGGAGGGGGAAGG + Intronic
978101936 4:104852346-104852368 TAGGGAATGGTGGTGGGGGAGGG - Intergenic
978211140 4:106136622-106136644 CAGGTTAAGTTGGTGGGGGAGGG - Intronic
979093389 4:116516253-116516275 TAGGGTAACCTGGAGGGGGCTGG + Intergenic
979184961 4:117776609-117776631 GAAGGATAGTTGGTGGGGGATGG + Intergenic
980563019 4:134502023-134502045 GAGGGGAAGGGGGTGGGAGAAGG - Intergenic
981808173 4:148741002-148741024 GTAGGTAGGCTGGTGGGGCAAGG - Intergenic
984330987 4:178318002-178318024 GAAGGTCAGCTGGCGGGTGAGGG - Intergenic
984767262 4:183409014-183409036 GAGTGTGGGCTGGTGGGGCAGGG + Intergenic
985393109 4:189513003-189513025 GAGGGGAAGCTGGCCTGGGAGGG - Intergenic
986026761 5:3858396-3858418 GAGGGGTAGCTGCTGAGGGAAGG + Intergenic
987103483 5:14613774-14613796 CAGACTAAGCTGGTGGAGGATGG + Intronic
987172026 5:15269143-15269165 CAGGGTAAGCTGGTTTAGGATGG + Intergenic
987710821 5:21499140-21499162 GAGTGTGAGCTGGCTGGGGAGGG - Intergenic
988215572 5:28268018-28268040 GAGGAAAGGCCGGTGGGGGAAGG + Intergenic
988685950 5:33525814-33525836 GAGGGTAAGTGGGTGGGTGGAGG - Exonic
988836892 5:35042167-35042189 GAAAGTAGGCTGGAGGGGGAAGG + Intronic
989019657 5:36988047-36988069 TAGGGTAAGCTGAGAGGGGAGGG - Intronic
990074409 5:51825516-51825538 GAAGGTATGAAGGTGGGGGATGG - Intergenic
990426213 5:55691780-55691802 GGGGGAAAACTGGTGGGGGAGGG + Intronic
990589644 5:57249751-57249773 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
990850135 5:60193876-60193898 GAGAGTAAGCTGGGTGAGGAAGG - Intronic
990917992 5:60931951-60931973 GAGCCCAAGCTGTTGGGGGAGGG - Intronic
991761161 5:69918198-69918220 GAGTGTGAGCTGGCTGGGGAGGG - Intergenic
991786168 5:70199902-70199924 GAGTGTGAGCTGGCTGGGGAGGG + Intergenic
991840389 5:70793248-70793270 GAGTGTGAGCTGGCTGGGGAGGG - Intergenic
991878612 5:71200288-71200310 GAGTGTGAGCTGGCTGGGGAGGG + Intergenic
992179460 5:74182527-74182549 GAGGGTGGGGTGGCGGGGGAGGG + Intergenic
992441313 5:76800056-76800078 GAGAAAAAGCTGATGGGGGAAGG + Intergenic
997485364 5:134226287-134226309 GAGGGCGGGGTGGTGGGGGAAGG + Intergenic
997756353 5:136403162-136403184 GAGGGGAGGCTGGAGGTGGATGG + Intergenic
997854216 5:137358540-137358562 GAGGGGAAGGTGGAGGGGAAGGG + Intronic
998159070 5:139802999-139803021 GAAGGAAAGCAGGTGGGGGCTGG + Intronic
998164767 5:139836727-139836749 GAGAGGAGGCTGGTGGGGAAAGG + Intronic
998462518 5:142320323-142320345 GGGGGTAGGGAGGTGGGGGAAGG - Intronic
998552471 5:143090673-143090695 CTGGGTTAGCTGATGGGGGAGGG + Intronic
999302987 5:150502504-150502526 GGGCCTATGCTGGTGGGGGAGGG + Intronic
999322549 5:150624574-150624596 GAGGCTGAGCGGGTGGAGGAGGG + Intronic
999327384 5:150651529-150651551 GAGGGTGACCTGGTGAGGGAAGG + Exonic
999361898 5:150992558-150992580 GAGGGGATGGTGGTGGGAGAAGG + Intergenic
999510866 5:152250475-152250497 CAGGGTAAGCGGGTGGTGGGAGG - Intergenic
1001301404 5:170536427-170536449 AATGGTCAGCTGTTGGGGGAAGG - Intronic
1001806399 5:174590400-174590422 AAGGGAAAGGTGGTGGGGGGGGG + Intergenic
1001955027 5:175843094-175843116 CAGGGTCAGCGGGTAGGGGAGGG + Intronic
1002211249 5:177600482-177600504 GGGGGGAAGGTGCTGGGGGAAGG - Intronic
1002212058 5:177605019-177605041 GAGGGAAAGGAGGTGGGGGCTGG - Intronic
1002888884 6:1317206-1317228 GGGGGTAGGCTGGAGGGGGGCGG - Intergenic
1002924573 6:1597606-1597628 GAAGCTGAGCTGGTGGGGGAAGG - Intergenic
1003624105 6:7727073-7727095 GGGGGGCAGCTGCTGGGGGACGG + Exonic
1003850562 6:10218159-10218181 GAGGGTGGGCTGGGGAGGGAGGG + Intergenic
1004026812 6:11827189-11827211 GGGTGTAATCTGGCGGGGGATGG + Intergenic
1005006599 6:21293418-21293440 GAGGGGAAGATGGGAGGGGAAGG - Intergenic
1005546866 6:26881363-26881385 GAGTGTGAGCTGGCTGGGGAGGG + Intergenic
1006142761 6:31940611-31940633 GAGGGCCAGGTGATGGGGGAGGG - Intronic
1006188301 6:32192522-32192544 GGGGAGAAACTGGTGGGGGAGGG + Exonic
1006384677 6:33723773-33723795 GAGGGGAGCCTGGTGGAGGAGGG + Intronic
1006689030 6:35863624-35863646 GAGGGGGAGGTGGAGGGGGAGGG + Intronic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1006945050 6:37779313-37779335 AAGGGTAGGGTGGAGGGGGAGGG + Intergenic
1007221370 6:40281670-40281692 GGGGGTGAGCTGGTGGGGGAGGG + Intergenic
1007263024 6:40576992-40577014 GAGGGAATGCTTGTGGGGGTGGG - Intronic
1007298240 6:40845164-40845186 TTGGGAAAGCAGGTGGGGGAAGG + Intergenic
1007646931 6:43390135-43390157 TAGAGCAAGATGGTGGGGGAGGG - Intergenic
1007656949 6:43456119-43456141 GAGGGAAGGGTGGTGGGGGTAGG - Exonic
1008674549 6:53805922-53805944 GAAGGTGAGGTGGTGGGGGTAGG - Intronic
1009017621 6:57922445-57922467 GAGTGTGAGCTGGCTGGGGAGGG + Intergenic
1010464329 6:76149228-76149250 GAGGGTAGGGAGCTGGGGGAGGG + Intergenic
1012437176 6:99226763-99226785 GAGGGGAAGCAGGTGTGGGTGGG - Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1013422260 6:109977989-109978011 GAGGGTGAGCTGGGAGGGGAGGG - Intergenic
1013455816 6:110328704-110328726 GAGTGTAAGCTGGTAGGCAAAGG - Intronic
1013535792 6:111061977-111061999 GATGCTGAGCTGGTGGGGGAGGG - Intergenic
1013676575 6:112470497-112470519 AAGAGTAAGATGGTGGGGTAGGG - Intergenic
1014490923 6:122060751-122060773 AAGGGTAAGCTGGTGGGGTTAGG + Intergenic
1014786718 6:125627749-125627771 GAGGGTAAGAGGGTGAGGGCGGG + Intergenic
1015510893 6:134037313-134037335 GAGGGTAAGCCTATGGAGGAGGG - Intronic
1016272285 6:142302395-142302417 GAGGGTGGGGTGGTCGGGGAGGG - Intronic
1017723409 6:157260045-157260067 GAGGATAATCTGGTGGAGGAAGG - Intergenic
1017958022 6:159195385-159195407 GAGAGGAAGATGGTGGGGGAAGG + Intronic
1018042098 6:159933830-159933852 CAGGGGAAGCTGATGGGGAATGG + Intergenic
1018301589 6:162408922-162408944 GAGGGAAAGCTGGGAGGGGAGGG - Intronic
1018546093 6:164937583-164937605 GAAGGTAAGCTGTTGGGAGAAGG - Intergenic
1018733378 6:166669672-166669694 GAGAGTGAGCTGGCAGGGGATGG - Intronic
1018911195 6:168101601-168101623 GAGGGTCGGCTGGGCGGGGAGGG - Intergenic
1018917089 6:168140220-168140242 GAGGGTGGGGTGGTGGGGCAGGG - Intergenic
1018948436 6:168363331-168363353 GAGAGGAAGATGGAGGGGGAGGG + Intergenic
1019103738 6:169651635-169651657 GAGGGGAAGCTGGTGGGGTGTGG - Intronic
1019707572 7:2503822-2503844 GAGGATCAGCTGGGGGTGGATGG - Intergenic
1019740433 7:2670337-2670359 GAGGGTACGCTTGGGTGGGAGGG + Intergenic
1019825308 7:3279523-3279545 GAGGGAAAGATGGGGGAGGAGGG + Intergenic
1019923774 7:4179387-4179409 GAGGGTGAGATGGGGGGGCAGGG + Intronic
1021805273 7:24349021-24349043 GCAGGTAAGTTGGTGTGGGAGGG + Intergenic
1022012053 7:26316708-26316730 GAGGGTAAGCAGGTGGACCAGGG + Intronic
1022505310 7:30905883-30905905 GAGGGTTTTCTGGTGGGGCAGGG - Intergenic
1022550845 7:31237644-31237666 GAGGGTGTGGCGGTGGGGGAGGG - Intergenic
1022573139 7:31472660-31472682 GAGGGTTAGGGGGTGGGGGATGG + Intergenic
1023637986 7:42232107-42232129 GGGGGCTAGGTGGTGGGGGAGGG - Intronic
1023908280 7:44537042-44537064 GAGGGTGAGCTGGTGGGGTGGGG + Intronic
1024283625 7:47738914-47738936 AAGGGGCAGCAGGTGGGGGAGGG - Intronic
1024727540 7:52215240-52215262 GAGCATAACCTGCTGGGGGAAGG + Intergenic
1025024800 7:55507365-55507387 GTGGGTGAGCTGGTGGGTGGGGG + Intronic
1025732438 7:64118514-64118536 GAGTGTGAGCTGGCTGGGGAGGG - Intronic
1025973035 7:66345958-66345980 GTGGGTAGGTGGGTGGGGGAGGG - Intronic
1026105946 7:67420857-67420879 GAGGGTGGGGGGGTGGGGGATGG + Intergenic
1026159095 7:67852960-67852982 GAGGGGATGCTGGAGGGAGAAGG + Intergenic
1026176587 7:68002906-68002928 GAGGGTGAGGGGGTGGGGGATGG + Intergenic
1026691266 7:72552049-72552071 CAGGGTCAGATGGTTGGGGAGGG - Intergenic
1027655891 7:80930430-80930452 GGGGGGAGGGTGGTGGGGGATGG - Intergenic
1028380685 7:90195412-90195434 CAGGATAAGCTGGTGGGGAACGG - Intronic
1028596658 7:92553318-92553340 GAGGATAGGCTGATGGTGGAGGG + Intergenic
1029126952 7:98301118-98301140 GAGGGTATGGCTGTGGGGGAGGG - Intronic
1029661525 7:101965437-101965459 CAGGGCATGGTGGTGGGGGAAGG + Intronic
1031417386 7:121509909-121509931 GAGCGGACGCTGGTGGAGGAAGG + Intergenic
1032080081 7:128854333-128854355 GAGGTTTAACTGATGGGGGAGGG + Intronic
1032761138 7:134943288-134943310 GGGGGTAGGGTGGTGGGGGTGGG + Intronic
1032860071 7:135868260-135868282 GAGGGAGAGAGGGTGGGGGAGGG + Intergenic
1032887849 7:136161727-136161749 GTGGGTAGGCTGCTGGGGGATGG + Intergenic
1033124796 7:138698158-138698180 GAGGGAAAGAAGGAGGGGGAAGG + Intronic
1033272330 7:139943912-139943934 AAGGGTCAGCTGCTGGGGGTGGG - Intronic
1034128960 7:148698724-148698746 GGGGAGAAGCTGTTGGGGGAGGG - Intronic
1034263607 7:149771712-149771734 GAGGGGAGTCTGCTGGGGGAGGG - Intronic
1034457079 7:151176362-151176384 CAGGGTAGGCTGGTGAGGGGTGG + Intronic
1034555348 7:151847014-151847036 GGGGGTAAGCGGCTGGGTGAGGG + Intronic
1034896325 7:154878617-154878639 GAGGATATGGTGGTGGTGGACGG - Intronic
1035214552 7:157355495-157355517 GGGTGAAAGCTGGTGGTGGAAGG + Intronic
1035407222 7:158607051-158607073 GAAGGTAAGGTGATGGAGGATGG + Intergenic
1036213799 8:6863258-6863280 TAGGGGAAGCTGGTGGAAGAGGG + Intergenic
1037502202 8:19496977-19496999 GAGGGGAGGCGGGAGGGGGAGGG - Intronic
1037613422 8:20495686-20495708 GGGGGGGATCTGGTGGGGGAGGG - Intergenic
1038439868 8:27564296-27564318 GAGGGTGAGTGGGTGGGTGAGGG + Intergenic
1038544492 8:28414678-28414700 GAGGGAAAGCTGGTGTGGAGGGG - Intronic
1038596460 8:28890577-28890599 GAGGGAAGGCGGGAGGGGGAGGG - Exonic
1039644644 8:39267221-39267243 GAGGCTGTGCTGGTGGGGAAAGG + Intronic
1040386048 8:46915832-46915854 GAGGGTAAGGTGTGGGGGGAAGG + Intergenic
1041111129 8:54483814-54483836 GAAGGAAAGGTGGTGGGGGCAGG - Intergenic
1041373639 8:57190746-57190768 GCGTGTGAGCTGGTGGGGGTGGG + Intergenic
1041845539 8:62323632-62323654 GAGGGAAAGCCACTGGGGGAGGG - Intronic
1041924398 8:63221581-63221603 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1042547027 8:69960131-69960153 GGGGGTTAACTGGTGGTGGAGGG - Intergenic
1043004846 8:74806804-74806826 GAGGAAAAGCTGATTGGGGAAGG - Intronic
1043922449 8:85998867-85998889 GAGAGTGAGATGGTGGGGGTGGG - Intronic
1044531036 8:93307738-93307760 GAGTATCAGTTGGTGGGGGAGGG - Intergenic
1044659190 8:94578730-94578752 GAGGGCAACCTGGAGGGGGCTGG + Intergenic
1044939084 8:97322123-97322145 CAGGCTAAGCTGCTGGGGCAGGG + Intergenic
1046131781 8:109975062-109975084 GGGTGTGAGCAGGTGGGGGAGGG + Exonic
1046620884 8:116528479-116528501 GAGAGAAAGCTGCTGGGGGTGGG - Intergenic
1047054361 8:121147592-121147614 GTGGGTGAGCTGGGGAGGGAGGG - Intergenic
1047344139 8:124010747-124010769 ATTGGGAAGCTGGTGGGGGAAGG + Intronic
1047905283 8:129466525-129466547 GAGGGTGAGCTGGTGGGAGGAGG - Intergenic
1047916871 8:129592416-129592438 GAGGGGAGGATGGTGGGGGTGGG + Intergenic
1048165042 8:132054882-132054904 GTGGGAAAGATGGTGGGGGTGGG + Intronic
1049002050 8:139832463-139832485 CAGGGGAGGCTGGTGGGGGTGGG + Intronic
1049284490 8:141767195-141767217 GAGGGCAGGCTTGTGTGGGAAGG + Intergenic
1049476603 8:142799806-142799828 GACGGGCAGCTGTTGGGGGATGG + Intergenic
1049950790 9:641745-641767 CAGGGTAAGCTGGTAGCTGAAGG - Intronic
1049988319 9:971856-971878 GAGGGCAGGCGGGTGGGGGAGGG - Intergenic
1050588985 9:7143071-7143093 TAGAGTAAGCTGGGAGGGGAGGG - Intergenic
1051068625 9:13135647-13135669 GAATGGAAGCTGGTGGGGAAAGG - Intronic
1051192862 9:14533623-14533645 GGGGATAAGCTGGTCGGTGAAGG - Intergenic
1051374599 9:16390308-16390330 GAGGCTAGGCTGGGGGTGGAGGG - Intergenic
1052951812 9:34219726-34219748 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1053618649 9:39794394-39794416 CAGGGTAAGGTGGGGTGGGAAGG - Intergenic
1054265506 9:62913035-62913057 CAGGGTAAGGTGGGGTGGGAAGG + Intergenic
1054543931 9:66299593-66299615 GAGGGTAAGGGGCTAGGGGAGGG - Intergenic
1055581437 9:77711048-77711070 GAGGGGAAGGAGGAGGGGGAGGG - Intergenic
1055650744 9:78404615-78404637 GTGAGTAAGATGGTAGGGGATGG - Intergenic
1055831776 9:80388080-80388102 GGGGGGAAGATGCTGGGGGAAGG - Intergenic
1057291031 9:93807663-93807685 GAGGGGACAATGGTGGGGGAGGG - Intergenic
1057292146 9:93813567-93813589 GATGGTAAGGTGGTGGTTGATGG - Intergenic
1057489710 9:95511324-95511346 GTGGCCAGGCTGGTGGGGGAGGG - Intronic
1058368485 9:104236102-104236124 GAGGGAGAGGTGGAGGGGGAGGG + Intergenic
1059392156 9:114006061-114006083 GAGGTGAAGCTGGTGGTGGGAGG + Intronic
1059649132 9:116298484-116298506 GAGGGGAAGATGGCGTGGGATGG + Intronic
1059747280 9:117215141-117215163 GATGCTCAGCTGGTGGGAGATGG - Intronic
1060398390 9:123332544-123332566 GCTGGTAAACTGCTGGGGGAAGG + Intergenic
1060401093 9:123349995-123350017 GAAGCTAAGCTGGTTGGAGAGGG + Intergenic
1060561554 9:124549136-124549158 GAGGGTTATCTGGTGGGGGATGG + Intronic
1060711724 9:125872409-125872431 GATGGTAAGATGATGGGGAAAGG + Intronic
1061133438 9:128720789-128720811 GAGGGCGAGCTGGAGGGGGAAGG - Exonic
1061791292 9:133060674-133060696 GAGAGGAAGGAGGTGGGGGAGGG - Intergenic
1062014196 9:134283081-134283103 GAGGGCAAGGCGGGGGGGGAGGG - Intergenic
1062085480 9:134645933-134645955 GAGGGAAGGATGGAGGGGGAAGG - Intronic
1062143715 9:134976690-134976712 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1062425430 9:136504013-136504035 GAGGAGGAGCTGGTGGGGGTGGG - Intronic
1062513257 9:136919654-136919676 GAGGGAAAGAAGGAGGGGGAGGG - Intronic
1062629658 9:137458199-137458221 GGGGGCCAGCTGGTGGGGGGAGG - Intronic
1203698891 Un_GL000214v1:119549-119571 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
1203699848 Un_GL000214v1:125847-125869 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
1203700750 Un_GL000214v1:131839-131861 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
1203479583 Un_GL000224v1:437-459 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
1203480550 Un_GL000224v1:6733-6755 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
1203549070 Un_KI270743v1:153234-153256 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
1203549380 Un_KI270743v1:155315-155337 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
1203550338 Un_KI270743v1:161627-161649 GGGGGTGAGCTGCTGGGTGATGG - Intergenic
1203568616 Un_KI270744v1:111561-111583 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
1203569188 Un_KI270744v1:115795-115817 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
1203570137 Un_KI270744v1:122084-122106 GGGGGTGAGCTGCTGGGTGATGG + Intergenic
1187391782 X:18890950-18890972 GAGGGCAAGCCGGTGGGGCCAGG - Intergenic
1187724732 X:22190608-22190630 CAGGGTATGCTGGTGAAGGAAGG + Intronic
1188000389 X:24974861-24974883 GAGCGTGAGCTGGTGAGGAAGGG + Intronic
1189946246 X:46182298-46182320 GAGAGTAAGATGGGAGGGGATGG + Intergenic
1190136506 X:47804189-47804211 GAGGAGGAGCTGGTGGTGGATGG - Intergenic
1190641047 X:52482883-52482905 GAGGGGAAGGGTGTGGGGGAGGG - Intergenic
1190646625 X:52529982-52530004 GAGGGGAAGGGTGTGGGGGAGGG + Intergenic
1192496678 X:71620913-71620935 GGAGGTAAGCTGCAGGGGGAGGG - Intergenic
1193188810 X:78545181-78545203 CAGTGCATGCTGGTGGGGGAAGG + Intergenic
1194063631 X:89235420-89235442 AAGGGTGAGCTGGTGGTAGAAGG - Intergenic
1194064470 X:89244449-89244471 GGGGGTAGGCGGCTGGGGGAAGG + Intergenic
1195105658 X:101599845-101599867 GAAGGCAAGCTGCGGGGGGAAGG - Intergenic
1195107225 X:101613922-101613944 GAAGGCAAGCTGCGGGGGGAAGG + Intergenic
1196649100 X:118150645-118150667 GAGGATAATTTGGTGGGTGAGGG - Intergenic
1197326198 X:125097100-125097122 GAGGGTAGGGTGGTGGTGGTTGG - Intergenic
1198682683 X:139199689-139199711 GAGGGTGAGCTGTGGGGCGAAGG - Intronic
1198762527 X:140047881-140047903 GAGGACAAGCTGGTGGGGGAAGG - Intergenic
1199872752 X:151913310-151913332 GATGGGGAGCTGGTGGAGGATGG - Intronic
1199989705 X:152979505-152979527 GAAGGAAAGGTGGTGGGGGCTGG - Intergenic
1200717805 Y:6569524-6569546 AAGGGTGAGCTGGTGGTAGAAGG - Intergenic
1200718642 Y:6578531-6578553 GGGGGTAGGCGGCTGGGGGAAGG + Intergenic
1202593925 Y:26516373-26516395 GAGAGTAAGGAGGTGGTGGAGGG + Intergenic