ID: 1168107916

View in Genome Browser
Species Human (GRCh38)
Location 19:54175365-54175387
Sequence CTTTTGCACCAGAAGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168107906_1168107916 17 Left 1168107906 19:54175325-54175347 CCTGAGAACTTGTGAGACATACA 0: 1
1: 0
2: 18
3: 156
4: 869
Right 1168107916 19:54175365-54175387 CTTTTGCACCAGAAGCCCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 222
1168107907_1168107916 -9 Left 1168107907 19:54175351-54175373 CCTTGTCCCCACCCCTTTTGCAC 0: 1
1: 0
2: 3
3: 51
4: 461
Right 1168107916 19:54175365-54175387 CTTTTGCACCAGAAGCCCTGGGG 0: 1
1: 0
2: 2
3: 22
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168107916 Original CRISPR CTTTTGCACCAGAAGCCCTG GGG Intronic
900987644 1:6082505-6082527 CTTTGGCACCAGAGGGACTGTGG - Intronic
901330873 1:8407520-8407542 CACTTGCAACAGAAGCTCTGTGG + Intronic
902616758 1:17627913-17627935 CTTTTGCGGCAGCAGCCCTAGGG - Intronic
902752392 1:18526145-18526167 CTGCTGGACCAGAAACCCTGAGG - Intergenic
903030315 1:20459310-20459332 CATTGGCCCCAGAAGCCCTGGGG - Intergenic
903501495 1:23802436-23802458 CTTGCCCACCTGAAGCCCTGGGG - Exonic
905406342 1:37735188-37735210 CTGAAGAACCAGAAGCCCTGCGG + Intronic
907267383 1:53271229-53271251 CTCCTGGACCAGAAGACCTGTGG - Exonic
908564399 1:65339815-65339837 TTTTTGCCCCAGAAGCCCAGGGG - Intronic
908801284 1:67883368-67883390 CTCTGGCACCAGAATTCCTGTGG - Intergenic
911958280 1:104265119-104265141 CCTTTGCATCAGATGCTCTGTGG - Intergenic
912965697 1:114235350-114235372 CTTTTTCTCCAGAAGCCCTGAGG + Intergenic
915115810 1:153598801-153598823 CTCTTGCCCCAGCAGTCCTGAGG + Intergenic
919135403 1:193501472-193501494 CTTCTGCACCATAAGCCCAAGGG + Intergenic
919855717 1:201704730-201704752 CTGTTGAATCAGAAGCTCTGGGG + Intronic
921027036 1:211294513-211294535 CTTTTACCCTACAAGCCCTGTGG + Intronic
923398360 1:233590180-233590202 TTTTTGCATCAGGAGCCTTGGGG - Intergenic
923564618 1:235067641-235067663 CTTCCCCACCAGAAGCCCTGGGG + Intergenic
924620872 1:245659638-245659660 CTTTTGCACCAGTAGGACAGAGG + Intronic
1063017969 10:2096865-2096887 CCTGTGCAGCAGAGGCCCTGGGG - Intergenic
1064011727 10:11741694-11741716 CTCTTGCACCAGCTCCCCTGTGG + Intergenic
1064035831 10:11912734-11912756 TTGTTGCAGCAGAAGCCCAGAGG - Intergenic
1065755396 10:28925708-28925730 CTTTTGCTTTACAAGCCCTGGGG + Intergenic
1066495340 10:35936993-35937015 CTCTTGGATCAGAATCCCTGGGG + Intergenic
1067218290 10:44322067-44322089 CTTATCCAACAGAAGCACTGGGG + Intergenic
1070772056 10:79088310-79088332 GTTTTGCCCAAGAAGCCTTGTGG - Intronic
1071360230 10:84839108-84839130 CTTATGTACCAGAACCACTGTGG + Intergenic
1072192596 10:93088634-93088656 CACTTCCACCAGATGCCCTGTGG - Intergenic
1076762646 10:132612977-132612999 CGTCTGCACCAGAGGCCATGGGG + Intronic
1078346737 11:10556458-10556480 CATTTGCAAGAGAAGCACTGTGG + Intergenic
1079353184 11:19710542-19710564 CTATTGAATCAAAAGCCCTGGGG - Intronic
1080613436 11:33925280-33925302 CTATTGCTCCAGAGGCCCTTAGG - Intergenic
1081244994 11:40754611-40754633 CTTATGCACCATACTCCCTGTGG + Intronic
1082591266 11:55013629-55013651 CTTTTTCACCATAAGCCCCAAGG - Intergenic
1084216914 11:67652488-67652510 ATTTTGCAGAAGAAACCCTGGGG + Intergenic
1085252816 11:75154751-75154773 TTTTGGCACCAGAGACCCTGGGG - Intronic
1085384429 11:76149059-76149081 CTTCCGCACCCCAAGCCCTGTGG + Intergenic
1087873776 11:103331339-103331361 TTTTTGTACCAGAAACCTTGGGG + Intronic
1089542039 11:119195078-119195100 CTTTTGCCACAGCAGACCTGAGG + Intronic
1090280112 11:125448469-125448491 CTTCTGCTCCAGGAGGCCTGGGG + Intronic
1091402055 12:187100-187122 TTTTTGCAGCAGAAGCCCTGAGG - Intergenic
1092967947 12:13663024-13663046 CTTCTACACCAGAAGCTCTAGGG - Intronic
1093264362 12:16984200-16984222 CTTTTGGACAAGAAACCCAGAGG + Intergenic
1096894049 12:54802241-54802263 CTTTTACACCAAAAGGTCTGCGG - Intergenic
1097445231 12:59662549-59662571 CCTGTTCACCAGGAGCCCTGGGG - Intronic
1098342599 12:69468288-69468310 CTTATGAATCAGAAGCTCTGGGG - Intergenic
1100830722 12:98515050-98515072 CTTTTGTTCCAGAAACCCAGGGG - Intergenic
1102039636 12:109792561-109792583 CTTATGCACCTGCAGACCTGAGG - Intronic
1102544058 12:113641925-113641947 TTTGAGCACCAGAAACCCTGCGG + Intergenic
1102754585 12:115327078-115327100 CTGCTGCATCAGAAGCCGTGGGG - Intergenic
1105604777 13:21917875-21917897 CCTGTGAAACAGAAGCCCTGCGG - Intergenic
1106635534 13:31524982-31525004 CTTTTGAATCAGAAACTCTGGGG - Intergenic
1107402841 13:40086152-40086174 CTACTGCACCAGGAGCCCTGGGG + Intergenic
1113140344 13:107141379-107141401 CTGCTGCACCAGAGGCCCAGGGG - Intergenic
1114317920 14:21524675-21524697 CTTTGGCTTCAGGAGCCCTGGGG + Exonic
1114721188 14:24883794-24883816 CTTTTGCAGAAGAATCCCAGGGG - Intronic
1119564416 14:75616434-75616456 TCTTTGCACCAGAGTCCCTGAGG - Intronic
1119673047 14:76534142-76534164 CTTTTGTACCAAGAGTCCTGAGG + Intergenic
1120893340 14:89508647-89508669 TTTGGGCATCAGAAGCCCTGGGG - Intronic
1121539065 14:94711555-94711577 CTGTGGCACAAGCAGCCCTGAGG - Intergenic
1122158896 14:99768642-99768664 CTCTTGCACCAGAACAGCTGGGG + Intronic
1125257689 15:37784454-37784476 CTTTTGGCCCAGTTGCCCTGGGG + Intergenic
1125616884 15:41022442-41022464 ATTTTGAACCAGAAGAACTGAGG + Intronic
1128378241 15:67092500-67092522 CTCTTGGATCAGAAACCCTGAGG + Intronic
1128603605 15:69018014-69018036 CTTCAGGACCAGAAGCTCTGAGG - Intronic
1129064643 15:72890559-72890581 CTGTTGCACCAGAACCCCTCAGG + Intergenic
1129179394 15:73862940-73862962 GTTTTGCAATTGAAGCCCTGAGG - Intergenic
1129700090 15:77762836-77762858 GTATTGCAGCAAAAGCCCTGGGG - Intronic
1131729097 15:95260279-95260301 CTTTTTCACCAGCAGGCTTGAGG - Intergenic
1132116182 15:99138054-99138076 CTTCTGCACCAGCATCCCTCAGG - Exonic
1132877547 16:2147089-2147111 CTTCTGCAGCTGCAGCCCTGGGG - Intronic
1133008886 16:2899207-2899229 ATTTGGCCCCAGAAGCCCTGCGG - Exonic
1133861765 16:9602225-9602247 CTTTTGCATTAGAAACCTTGAGG - Intergenic
1133983508 16:10650932-10650954 CTTGTGCACTAGAAACACTGGGG + Intronic
1136741334 16:32531509-32531531 CTTTTTCACCATAGGCCTTGAGG + Intergenic
1138549843 16:57741581-57741603 CTTTGGAACCTGAAGCCCAGTGG - Intronic
1141726387 16:85791908-85791930 CTTTTGCTACATAAGGCCTGGGG + Intronic
1203028269 16_KI270728v1_random:543725-543747 CTTTTTCACCATAGGCCTTGAGG - Intergenic
1203043452 16_KI270728v1_random:790706-790728 CTTTTTCACCATAGGCCTTGAGG + Intergenic
1143223505 17:5281738-5281760 CCTCTGCACCAGAAGACCTGGGG + Intergenic
1144539857 17:16130382-16130404 CTTTTGCTCCAGCCACCCTGTGG - Intronic
1147167377 17:38600795-38600817 CTTTTGGAGCAGAAGTGCTGAGG + Intronic
1147322810 17:39656411-39656433 CATTTTCACCAGGACCCCTGAGG - Intronic
1147920267 17:43912027-43912049 CTGGGGCTCCAGAAGCCCTGGGG - Intergenic
1148332821 17:46822115-46822137 CTGTTCCTCCATAAGCCCTGTGG - Intronic
1150221163 17:63496668-63496690 CTTAGGCACCTGGAGCCCTGGGG + Intronic
1150281741 17:63932880-63932902 CTCTTGCTCCAGAACCTCTGTGG - Intergenic
1150975503 17:70081699-70081721 CTTGTGCAACAGAAGCACAGGGG + Intronic
1151593534 17:75062854-75062876 GTTTCGCACCAGAAGCACTGCGG + Intronic
1151673043 17:75582962-75582984 CTTGAGCATAAGAAGCCCTGAGG + Intergenic
1156527259 18:37778602-37778624 CTTCTGCACCTGAGGCCTTGCGG + Intergenic
1157220631 18:45826382-45826404 CATCTGCATCAGAATCCCTGGGG + Intronic
1159605743 18:70473032-70473054 CTTTGGCATCAGAAGCTCTGGGG - Intergenic
1160763049 19:795447-795469 CTCTGGCACCAGACGCCCGGCGG + Intergenic
1160856712 19:1221094-1221116 CTGCTGGACCAGAGGCCCTGTGG - Intronic
1161246190 19:3253597-3253619 TTCTAGCACCAGAAGCCCAGGGG + Intronic
1162039593 19:7962085-7962107 CTTTTAAACCAGGAGCCCGGAGG - Exonic
1162161499 19:8721236-8721258 CTTTTGCATCAGAACCCCTCTGG - Intergenic
1164544164 19:29145254-29145276 CCTTTGCACCAGAATCCCCTGGG - Intergenic
1165303860 19:34991070-34991092 CTTTTCCACAAGAAGAGCTGAGG - Intergenic
1168107916 19:54175365-54175387 CTTTTGCACCAGAAGCCCTGGGG + Intronic
1168146862 19:54424484-54424506 CTCTTGCACCTGCTGCCCTGCGG - Intronic
1168229980 19:55024741-55024763 CTACTGAAGCAGAAGCCCTGGGG + Intronic
1168592240 19:57646954-57646976 TTTTTGCACCAGAAGCCCATGGG - Intergenic
925589315 2:5493909-5493931 GTTTTGCTTAAGAAGCCCTGGGG + Intergenic
926069830 2:9878145-9878167 CTTCTGAATCAGAAACCCTGGGG + Intronic
926246082 2:11123276-11123298 CCTTTGCAGCAGCAGCCTTGTGG - Intergenic
926415633 2:12646837-12646859 TTTTTGCTTCAGAAACCCTGTGG + Intergenic
926615679 2:14994659-14994681 CTCTAGCACCTGTAGCCCTGGGG + Intergenic
927515900 2:23671605-23671627 CTTTGGAAGCAGAAGCCCTGAGG + Intronic
927920483 2:26968688-26968710 CTTTGGCACCAATAGTCCTGCGG + Intergenic
928197134 2:29224013-29224035 CTTTGGCTCCAGAACCCCTTAGG - Intronic
929727626 2:44446740-44446762 CTTTGACACCACAAACCCTGTGG - Intronic
930278612 2:49342611-49342633 CTTTTGCACCAGAACACCCATGG - Intergenic
930641151 2:53855665-53855687 TCTTTGCAGCAGAAGCACTGCGG + Intronic
931653301 2:64488177-64488199 CTTTTGCTCCTGCAGCCCTCGGG + Intergenic
933238804 2:79896470-79896492 ATTTTGCTCCAGAAGCCTTTTGG + Intronic
933839703 2:86276522-86276544 CTTATGCACCCAATGCCCTGCGG + Intronic
934166221 2:89296623-89296645 CTTCTGCACCAGATGCTCTCTGG + Intergenic
934201053 2:89885833-89885855 CTTCTGCACCAGATGCTCTCTGG - Intergenic
935290673 2:101608267-101608289 CTATTGGACTAGGAGCCCTGAGG - Intergenic
936711450 2:115136195-115136217 ATTGTGCAGCAGTAGCCCTGAGG + Intronic
937257510 2:120565511-120565533 CTTTGGCACCAGAAGCACGGGGG + Intergenic
938243847 2:129762688-129762710 CTCCTCCACCTGAAGCCCTGAGG - Intergenic
942848376 2:180453783-180453805 CTCTTGAATCAGAAGCTCTGGGG + Intergenic
944119398 2:196224682-196224704 CTTTCCCACCAGAAAACCTGTGG - Intronic
944285636 2:197946980-197947002 CTTCTCCTCCAGAAGCCCTAAGG - Intronic
945109343 2:206347690-206347712 TTTTTGCATCCGAAACCCTGGGG + Intergenic
946378679 2:219330108-219330130 CTACTGCATCAGAAGCCCTAGGG - Intronic
948546209 2:238730553-238730575 CTACTGCATCAGAAACCCTGGGG + Intergenic
948640173 2:239370694-239370716 CTGGTGCACCTGCAGCCCTGCGG + Intronic
1168934529 20:1652124-1652146 GTTTTGCGTTAGAAGCCCTGGGG - Intronic
1168937635 20:1680251-1680273 TTTCTGCATCAAAAGCCCTGGGG - Intergenic
1168940014 20:1701553-1701575 TTTTTGCATCAAAGGCCCTGGGG - Intergenic
1169672807 20:8122717-8122739 CTTAGGTACCAGAAGCCCAGGGG - Intergenic
1170404881 20:16025682-16025704 CTTGAGCACCAGAGGGCCTGGGG - Intronic
1170828714 20:19820751-19820773 CTATCGCATCAGAAACCCTGAGG - Intergenic
1170986827 20:21266472-21266494 GTGTTGGACCTGAAGCCCTGGGG - Intergenic
1173852390 20:46227395-46227417 CTTCTGTCCCAGAAGCTCTGAGG - Intronic
1173954206 20:47018186-47018208 CTGTGGCCTCAGAAGCCCTGAGG - Intronic
1174695472 20:52552349-52552371 CTTATCCAACAGGAGCCCTGTGG - Intergenic
1174997367 20:55585585-55585607 CTTTTGCTAGAGAAGCCCTGTGG - Intergenic
1176759354 21:10763024-10763046 CTTTTGGACCAGAGGCCCCAAGG + Intergenic
1179162576 21:38910271-38910293 CTTTTGTCCCTGAAGCCCTTTGG + Intergenic
1179481610 21:41682094-41682116 CTTCTGCACCTGGACCCCTGGGG + Intergenic
1180040866 21:45278974-45278996 ATTTTGCATCAAGAGCCCTGGGG - Intronic
1180400228 22:12410997-12411019 CTTTTCCACCATAAGCCCCAAGG - Intergenic
1181582544 22:23836238-23836260 CTTCTGCACCTGAATCCATGGGG + Intronic
1181864091 22:25841506-25841528 CTTTTGGACCAGCAGACCTGTGG + Intronic
1185045933 22:48528789-48528811 CGCTTGCACCAGGAGCACTGGGG + Intronic
1185275132 22:49947476-49947498 CTGGTGCACCAGAAGCCACGAGG - Intergenic
950425495 3:12922890-12922912 AGTCTGCACCAGGAGCCCTGAGG + Intronic
951412440 3:22381330-22381352 CTTGTGAGCCAGAAGTCCTGAGG + Intergenic
952605673 3:35144729-35144751 CTTATGCACCAGAGCTCCTGTGG + Intergenic
954856821 3:53651034-53651056 CTGTTGCACCAGAACCTCTCAGG + Intronic
958110542 3:89137934-89137956 CTGTTGCATTAGAAACCCTGAGG + Intronic
958874050 3:99595426-99595448 ATTTTTCTCCAGAAGCTCTGTGG - Intergenic
960989450 3:123301298-123301320 CCTTGGCTCCAGAAGGCCTGAGG - Intronic
962619440 3:137162660-137162682 CTGTCCCACCACAAGCCCTGAGG - Intergenic
963329163 3:143894944-143894966 CTTATGCACCTGAATCCCTCTGG + Intergenic
963414672 3:144979566-144979588 CTTTGGCACCAGAAGAGCTCAGG - Intergenic
963751059 3:149180431-149180453 CAGTTGCACAGGAAGCCCTGAGG - Intronic
965641505 3:170833566-170833588 CTTTTGTATCAGAAACTCTGGGG + Intronic
966819380 3:183913082-183913104 CTTATCCCCCAGCAGCCCTGTGG - Intergenic
968640802 4:1713451-1713473 CTTTTGCACCTGCTGCCCTCAGG + Intergenic
968981339 4:3851381-3851403 CATTTGCATAACAAGCCCTGCGG + Intergenic
969115443 4:4868119-4868141 CTGTGTCACCAGAACCCCTGTGG - Intergenic
971249165 4:24957961-24957983 CTTTTGCACCAGATACTCTCTGG - Intronic
971432554 4:26583868-26583890 CTTGTGCATCAGAGGCGCTGTGG + Intronic
974624038 4:64399539-64399561 CCCTCCCACCAGAAGCCCTGAGG + Intronic
980830960 4:138128790-138128812 ATCTTGCATAAGAAGCCCTGGGG + Intergenic
980945308 4:139313941-139313963 CATTTTCCCCATAAGCCCTGTGG - Intronic
981189744 4:141848298-141848320 CTTTTGCACAAGACGGCTTGGGG - Intergenic
982408644 4:155047619-155047641 CTCTTGAACCATGAGCCCTGTGG + Intergenic
982537563 4:156625765-156625787 CCTTTTCACCTGAAGCCTTGTGG - Intergenic
982902569 4:161025629-161025651 TTTTTGCACCAGAAGTCCTTGGG - Intergenic
985086244 4:186315811-186315833 TTTTACCTCCAGAAGCCCTGCGG + Intergenic
990950076 5:61289852-61289874 CTCTTGCACCACTGGCCCTGGGG + Intergenic
993728771 5:91398025-91398047 CTTTTCCACTACCAGCCCTGGGG - Intergenic
994127900 5:96190293-96190315 ATTCTGCATCAGAAGTCCTGGGG + Intergenic
997240213 5:132301298-132301320 CTTGTGCTCCAGAGGCCCTGGGG + Intronic
1001191739 5:169637915-169637937 CTTTTTCCCCAGAGGCTCTGGGG - Intronic
1001255938 5:170183688-170183710 CTTTTTGACCAGAAGTCCAGAGG - Intergenic
1001980210 5:176033175-176033197 CTTTTTCCCCAGAGGCACTGGGG + Intronic
1002237173 5:177810488-177810510 CTTTTTCCCCAGAGGCACTGGGG - Intergenic
1004322099 6:14639926-14639948 CTCTCAGACCAGAAGCCCTGGGG - Intergenic
1004754716 6:18599528-18599550 CTATTTCACCAGAAGCTATGGGG + Intergenic
1005267620 6:24128708-24128730 CTTTTGCAGCACTGGCCCTGTGG + Intronic
1006828382 6:36953803-36953825 CTGATGCACCAGGAGCTCTGAGG - Intronic
1006901330 6:37503905-37503927 CCTTGGCACAGGAAGCCCTGTGG - Intergenic
1009492271 6:64306179-64306201 CTTTTCCTTTAGAAGCCCTGTGG - Intronic
1010209932 6:73354500-73354522 CTTTCGCACCAGAATCCCATGGG + Intergenic
1010984827 6:82411829-82411851 CTTTTGCTGAAGCAGCCCTGGGG - Intergenic
1014100959 6:117511154-117511176 CTTGTGCATAAGAAGACCTGAGG + Intronic
1015822986 6:137282719-137282741 CTGTTGCACCAGATGATCTGGGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022089260 7:27096929-27096951 GTTTTGCACCGGGAGCCCTCCGG + Intergenic
1022416273 7:30179877-30179899 CTTTTGAATCAGAAACTCTGGGG - Intergenic
1022873945 7:34508597-34508619 CTCTAGTACAAGAAGCCCTGGGG + Intergenic
1023156286 7:37255879-37255901 CTCTCTCACCAGAAGCCGTGGGG + Intronic
1026290160 7:68998874-68998896 CTGGTTCAACAGAAGCCCTGAGG - Intergenic
1029182308 7:98711887-98711909 TCTTTGTACCACAAGCCCTGAGG - Intergenic
1032136464 7:129283733-129283755 TTTTTGTACCACAGGCCCTGAGG + Intronic
1034463714 7:151213234-151213256 CTATTGAACCAGAAACGCTGAGG + Intronic
1035495246 7:159319772-159319794 TTTTTGCATCTGAAGCCATGTGG + Intergenic
1035986958 8:4444821-4444843 CATTTGCACCTGAAGGCTTGTGG - Intronic
1037591923 8:20319899-20319921 CTGTAGAACCAGAAGCTCTGAGG + Intergenic
1038363091 8:26902434-26902456 CTTCAGCATCAGTAGCCCTGAGG - Intergenic
1038488971 8:27955867-27955889 TTCATGCATCAGAAGCCCTGAGG - Intronic
1038584941 8:28779834-28779856 CAGTTACACCAGAAGCACTGGGG - Intronic
1039878676 8:41609536-41609558 GTGTGGCACCAGAAGCACTGGGG - Intronic
1039943780 8:42113122-42113144 CCTCTCTACCAGAAGCCCTGAGG + Intergenic
1039969109 8:42306592-42306614 TTTTGCCACCAGATGCCCTGTGG + Intronic
1040517597 8:48147365-48147387 CCTTTGCACCACCCGCCCTGGGG + Intergenic
1040568333 8:48586854-48586876 CCTCTGTACCAGAAGCACTGGGG - Intergenic
1041784001 8:61611118-61611140 CTTTTTCACCAGGCTCCCTGGGG - Intronic
1045141061 8:99283391-99283413 TTTTTGCACCAAAAGCCCAGTGG - Intronic
1046604628 8:116357416-116357438 CTACTGAACCAGAAGCTCTGGGG - Intergenic
1047578300 8:126182937-126182959 CCTTAGCACCAGCAACCCTGTGG - Intergenic
1048730215 8:137431695-137431717 CTTCTACACCATAAGCCCTGCGG - Intergenic
1049099534 8:140569040-140569062 CTTCTGCACCTGAAGGCTTGGGG - Intronic
1050652938 9:7792544-7792566 CTACTGAATCAGAAGCCCTGGGG - Intergenic
1052245861 9:26333803-26333825 CTACTGCACCAGAAACTCTGTGG - Intergenic
1056499127 9:87190550-87190572 CTTTTACACTAGTAGCCTTGAGG + Intergenic
1057577281 9:96253246-96253268 CTATTGCATCAGAAACTCTGTGG + Intronic
1058744884 9:107980808-107980830 CTTATGCACCAGAAACTTTGAGG - Intergenic
1059837382 9:118170994-118171016 CTACTGCACCAGAAACTCTGGGG - Intergenic
1062150129 9:135013898-135013920 CTTTCCCTCCAGGAGCCCTGAGG + Intergenic
1062253790 9:135611450-135611472 CTTTTCCACCAGAAGGGATGGGG + Intergenic
1203404717 Un_KI270507v1:4195-4217 CCTTTGCACCATAAGCCTCGAGG - Intergenic
1203413332 Un_KI270589v1:18648-18670 CTTTTGCACCAGAAGCCTCAAGG + Intergenic
1203684982 Un_KI270757v1:40564-40586 CTTTTGCACCAGAAGCCTCAAGG - Intergenic
1185669859 X:1799318-1799340 CTTTCAAACCAGAACCCCTGTGG + Intergenic
1186219184 X:7331403-7331425 CTTTTCCACCAAGAGCCATGAGG + Intronic
1187785454 X:22880353-22880375 CTACTGTATCAGAAGCCCTGTGG - Intergenic
1190409747 X:50124810-50124832 ATTTTCCCCCATAAGCCCTGTGG + Intergenic
1190458912 X:50651540-50651562 CTTTTGGATCAGAAACTCTGGGG + Intronic
1191692198 X:63952232-63952254 CTTTTGCTCCAGAATGACTGTGG + Intergenic
1193483683 X:82059771-82059793 CTTCTGCACCAAAACCTCTGGGG - Intergenic
1194584778 X:95718910-95718932 TTCTTGCATCAGAAGCCCTGGGG - Intergenic
1197550563 X:127887418-127887440 ACCCTGCACCAGAAGCCCTGGGG + Intergenic
1198016843 X:132620195-132620217 CTCCTGCTCCAGAAGCTCTGTGG - Intergenic
1198446814 X:136725556-136725578 CTTTTACATTAGATGCCCTGTGG - Intronic
1198483031 X:137058303-137058325 TTTTTGCACTAGAAGCACTTAGG + Intergenic
1199528715 X:148823081-148823103 CTTTTGCATCAAAAGCACTAGGG - Intronic
1200814567 Y:7518190-7518212 CTTATGGGCCACAAGCCCTGTGG + Intergenic
1201588171 Y:15584686-15584708 CTTTTCCACCAAGAGCCATGTGG + Intergenic