ID: 1168110548

View in Genome Browser
Species Human (GRCh38)
Location 19:54189425-54189447
Sequence AGAAGGAGCAGGCGGCGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 428}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168110548_1168110556 -10 Left 1168110548 19:54189425-54189447 CCCCCGCGCCGCCTGCTCCTTCT 0: 1
1: 0
2: 3
3: 32
4: 428
Right 1168110556 19:54189438-54189460 TGCTCCTTCTGGGCGCCCGCCGG 0: 1
1: 0
2: 2
3: 9
4: 123
1168110548_1168110566 23 Left 1168110548 19:54189425-54189447 CCCCCGCGCCGCCTGCTCCTTCT 0: 1
1: 0
2: 3
3: 32
4: 428
Right 1168110566 19:54189471-54189493 TCAGGCCGGGGAAGAAGCCACGG 0: 1
1: 0
2: 1
3: 22
4: 324
1168110548_1168110564 10 Left 1168110548 19:54189425-54189447 CCCCCGCGCCGCCTGCTCCTTCT 0: 1
1: 0
2: 3
3: 32
4: 428
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110548_1168110565 11 Left 1168110548 19:54189425-54189447 CCCCCGCGCCGCCTGCTCCTTCT 0: 1
1: 0
2: 3
3: 32
4: 428
Right 1168110565 19:54189459-54189481 GGGCTGCGCAGATCAGGCCGGGG 0: 1
1: 0
2: 1
3: 10
4: 144
1168110548_1168110568 28 Left 1168110548 19:54189425-54189447 CCCCCGCGCCGCCTGCTCCTTCT 0: 1
1: 0
2: 3
3: 32
4: 428
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110548_1168110569 29 Left 1168110548 19:54189425-54189447 CCCCCGCGCCGCCTGCTCCTTCT 0: 1
1: 0
2: 3
3: 32
4: 428
Right 1168110569 19:54189477-54189499 CGGGGAAGAAGCCACGGTCAGGG 0: 1
1: 0
2: 1
3: 14
4: 133
1168110548_1168110560 5 Left 1168110548 19:54189425-54189447 CCCCCGCGCCGCCTGCTCCTTCT 0: 1
1: 0
2: 3
3: 32
4: 428
Right 1168110560 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 6
4: 83
1168110548_1168110563 9 Left 1168110548 19:54189425-54189447 CCCCCGCGCCGCCTGCTCCTTCT 0: 1
1: 0
2: 3
3: 32
4: 428
Right 1168110563 19:54189457-54189479 CCGGGCTGCGCAGATCAGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 135
1168110548_1168110557 -9 Left 1168110548 19:54189425-54189447 CCCCCGCGCCGCCTGCTCCTTCT 0: 1
1: 0
2: 3
3: 32
4: 428
Right 1168110557 19:54189439-54189461 GCTCCTTCTGGGCGCCCGCCGGG 0: 1
1: 1
2: 0
3: 13
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168110548 Original CRISPR AGAAGGAGCAGGCGGCGCGG GGG (reversed) Exonic