ID: 1168110550

View in Genome Browser
Species Human (GRCh38)
Location 19:54189427-54189449
Sequence CCAGAAGGAGCAGGCGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 388}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168110550_1168110563 7 Left 1168110550 19:54189427-54189449 CCCGCGCCGCCTGCTCCTTCTGG 0: 1
1: 0
2: 6
3: 36
4: 388
Right 1168110563 19:54189457-54189479 CCGGGCTGCGCAGATCAGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 135
1168110550_1168110560 3 Left 1168110550 19:54189427-54189449 CCCGCGCCGCCTGCTCCTTCTGG 0: 1
1: 0
2: 6
3: 36
4: 388
Right 1168110560 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 6
4: 83
1168110550_1168110564 8 Left 1168110550 19:54189427-54189449 CCCGCGCCGCCTGCTCCTTCTGG 0: 1
1: 0
2: 6
3: 36
4: 388
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110550_1168110566 21 Left 1168110550 19:54189427-54189449 CCCGCGCCGCCTGCTCCTTCTGG 0: 1
1: 0
2: 6
3: 36
4: 388
Right 1168110566 19:54189471-54189493 TCAGGCCGGGGAAGAAGCCACGG 0: 1
1: 0
2: 1
3: 22
4: 324
1168110550_1168110565 9 Left 1168110550 19:54189427-54189449 CCCGCGCCGCCTGCTCCTTCTGG 0: 1
1: 0
2: 6
3: 36
4: 388
Right 1168110565 19:54189459-54189481 GGGCTGCGCAGATCAGGCCGGGG 0: 1
1: 0
2: 1
3: 10
4: 144
1168110550_1168110569 27 Left 1168110550 19:54189427-54189449 CCCGCGCCGCCTGCTCCTTCTGG 0: 1
1: 0
2: 6
3: 36
4: 388
Right 1168110569 19:54189477-54189499 CGGGGAAGAAGCCACGGTCAGGG 0: 1
1: 0
2: 1
3: 14
4: 133
1168110550_1168110568 26 Left 1168110550 19:54189427-54189449 CCCGCGCCGCCTGCTCCTTCTGG 0: 1
1: 0
2: 6
3: 36
4: 388
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168110550 Original CRISPR CCAGAAGGAGCAGGCGGCGC GGG (reversed) Exonic