ID: 1168110552

View in Genome Browser
Species Human (GRCh38)
Location 19:54189428-54189450
Sequence CCCAGAAGGAGCAGGCGGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 283}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168110552_1168110560 2 Left 1168110552 19:54189428-54189450 CCGCGCCGCCTGCTCCTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 283
Right 1168110560 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 6
4: 83
1168110552_1168110563 6 Left 1168110552 19:54189428-54189450 CCGCGCCGCCTGCTCCTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 283
Right 1168110563 19:54189457-54189479 CCGGGCTGCGCAGATCAGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 135
1168110552_1168110564 7 Left 1168110552 19:54189428-54189450 CCGCGCCGCCTGCTCCTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 283
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110552_1168110568 25 Left 1168110552 19:54189428-54189450 CCGCGCCGCCTGCTCCTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 283
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110552_1168110565 8 Left 1168110552 19:54189428-54189450 CCGCGCCGCCTGCTCCTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 283
Right 1168110565 19:54189459-54189481 GGGCTGCGCAGATCAGGCCGGGG 0: 1
1: 0
2: 1
3: 10
4: 144
1168110552_1168110566 20 Left 1168110552 19:54189428-54189450 CCGCGCCGCCTGCTCCTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 283
Right 1168110566 19:54189471-54189493 TCAGGCCGGGGAAGAAGCCACGG 0: 1
1: 0
2: 1
3: 22
4: 324
1168110552_1168110569 26 Left 1168110552 19:54189428-54189450 CCGCGCCGCCTGCTCCTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 283
Right 1168110569 19:54189477-54189499 CGGGGAAGAAGCCACGGTCAGGG 0: 1
1: 0
2: 1
3: 14
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168110552 Original CRISPR CCCAGAAGGAGCAGGCGGCG CGG (reversed) Exonic