ID: 1168110554

View in Genome Browser
Species Human (GRCh38)
Location 19:54189433-54189455
Sequence GGGCGCCCAGAAGGAGCAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 419}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168110554_1168110571 28 Left 1168110554 19:54189433-54189455 CCGCCTGCTCCTTCTGGGCGCCC 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1168110571 19:54189484-54189506 GAAGCCACGGTCAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 252
1168110554_1168110563 1 Left 1168110554 19:54189433-54189455 CCGCCTGCTCCTTCTGGGCGCCC 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1168110563 19:54189457-54189479 CCGGGCTGCGCAGATCAGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 135
1168110554_1168110569 21 Left 1168110554 19:54189433-54189455 CCGCCTGCTCCTTCTGGGCGCCC 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1168110569 19:54189477-54189499 CGGGGAAGAAGCCACGGTCAGGG 0: 1
1: 0
2: 1
3: 14
4: 133
1168110554_1168110565 3 Left 1168110554 19:54189433-54189455 CCGCCTGCTCCTTCTGGGCGCCC 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1168110565 19:54189459-54189481 GGGCTGCGCAGATCAGGCCGGGG 0: 1
1: 0
2: 1
3: 10
4: 144
1168110554_1168110570 27 Left 1168110554 19:54189433-54189455 CCGCCTGCTCCTTCTGGGCGCCC 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1168110570 19:54189483-54189505 AGAAGCCACGGTCAGGGCCCCGG 0: 1
1: 0
2: 0
3: 25
4: 247
1168110554_1168110564 2 Left 1168110554 19:54189433-54189455 CCGCCTGCTCCTTCTGGGCGCCC 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110554_1168110568 20 Left 1168110554 19:54189433-54189455 CCGCCTGCTCCTTCTGGGCGCCC 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110554_1168110560 -3 Left 1168110554 19:54189433-54189455 CCGCCTGCTCCTTCTGGGCGCCC 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1168110560 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 6
4: 83
1168110554_1168110566 15 Left 1168110554 19:54189433-54189455 CCGCCTGCTCCTTCTGGGCGCCC 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1168110566 19:54189471-54189493 TCAGGCCGGGGAAGAAGCCACGG 0: 1
1: 0
2: 1
3: 22
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168110554 Original CRISPR GGGCGCCCAGAAGGAGCAGG CGG (reversed) Exonic