ID: 1168110555

View in Genome Browser
Species Human (GRCh38)
Location 19:54189436-54189458
Sequence GGCGGGCGCCCAGAAGGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 238}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168110555_1168110564 -1 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110555_1168110568 17 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110555_1168110572 28 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110572 19:54189487-54189509 GCCACGGTCAGGGCCCCGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 210
1168110555_1168110569 18 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110569 19:54189477-54189499 CGGGGAAGAAGCCACGGTCAGGG 0: 1
1: 0
2: 1
3: 14
4: 133
1168110555_1168110566 12 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110566 19:54189471-54189493 TCAGGCCGGGGAAGAAGCCACGG 0: 1
1: 0
2: 1
3: 22
4: 324
1168110555_1168110560 -6 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110560 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 6
4: 83
1168110555_1168110574 29 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110574 19:54189488-54189510 CCACGGTCAGGGCCCCGGGCGGG 0: 1
1: 0
2: 4
3: 23
4: 262
1168110555_1168110571 25 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110571 19:54189484-54189506 GAAGCCACGGTCAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 252
1168110555_1168110563 -2 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110563 19:54189457-54189479 CCGGGCTGCGCAGATCAGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 135
1168110555_1168110565 0 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110565 19:54189459-54189481 GGGCTGCGCAGATCAGGCCGGGG 0: 1
1: 0
2: 1
3: 10
4: 144
1168110555_1168110570 24 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110570 19:54189483-54189505 AGAAGCCACGGTCAGGGCCCCGG 0: 1
1: 0
2: 0
3: 25
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168110555 Original CRISPR GGCGGGCGCCCAGAAGGAGC AGG (reversed) Exonic