ID: 1168110558

View in Genome Browser
Species Human (GRCh38)
Location 19:54189442-54189464
Sequence CAGCCCGGCGGGCGCCCAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 131}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168110558_1168110574 23 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110574 19:54189488-54189510 CCACGGTCAGGGCCCCGGGCGGG 0: 1
1: 0
2: 4
3: 23
4: 262
1168110558_1168110564 -7 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110558_1168110575 27 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110575 19:54189492-54189514 GGTCAGGGCCCCGGGCGGGCAGG 0: 1
1: 0
2: 1
3: 51
4: 528
1168110558_1168110566 6 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110566 19:54189471-54189493 TCAGGCCGGGGAAGAAGCCACGG 0: 1
1: 0
2: 1
3: 22
4: 324
1168110558_1168110568 11 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110558_1168110571 19 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110571 19:54189484-54189506 GAAGCCACGGTCAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 252
1168110558_1168110565 -6 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110565 19:54189459-54189481 GGGCTGCGCAGATCAGGCCGGGG 0: 1
1: 0
2: 1
3: 10
4: 144
1168110558_1168110576 28 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110576 19:54189493-54189515 GTCAGGGCCCCGGGCGGGCAGGG 0: 1
1: 0
2: 1
3: 22
4: 361
1168110558_1168110563 -8 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110563 19:54189457-54189479 CCGGGCTGCGCAGATCAGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 135
1168110558_1168110569 12 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110569 19:54189477-54189499 CGGGGAAGAAGCCACGGTCAGGG 0: 1
1: 0
2: 1
3: 14
4: 133
1168110558_1168110572 22 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110572 19:54189487-54189509 GCCACGGTCAGGGCCCCGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 210
1168110558_1168110570 18 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110570 19:54189483-54189505 AGAAGCCACGGTCAGGGCCCCGG 0: 1
1: 0
2: 0
3: 25
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168110558 Original CRISPR CAGCCCGGCGGGCGCCCAGA AGG (reversed) Exonic