ID: 1168110559

View in Genome Browser
Species Human (GRCh38)
Location 19:54189453-54189475
Sequence CCTGATCTGCGCAGCCCGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168110559_1168110568 0 Left 1168110559 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110559_1168110570 7 Left 1168110559 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1168110570 19:54189483-54189505 AGAAGCCACGGTCAGGGCCCCGG 0: 1
1: 0
2: 0
3: 25
4: 247
1168110559_1168110566 -5 Left 1168110559 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1168110566 19:54189471-54189493 TCAGGCCGGGGAAGAAGCCACGG 0: 1
1: 0
2: 1
3: 22
4: 324
1168110559_1168110572 11 Left 1168110559 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1168110572 19:54189487-54189509 GCCACGGTCAGGGCCCCGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 210
1168110559_1168110571 8 Left 1168110559 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1168110571 19:54189484-54189506 GAAGCCACGGTCAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 252
1168110559_1168110576 17 Left 1168110559 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1168110576 19:54189493-54189515 GTCAGGGCCCCGGGCGGGCAGGG 0: 1
1: 0
2: 1
3: 22
4: 361
1168110559_1168110569 1 Left 1168110559 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1168110569 19:54189477-54189499 CGGGGAAGAAGCCACGGTCAGGG 0: 1
1: 0
2: 1
3: 14
4: 133
1168110559_1168110580 29 Left 1168110559 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1168110580 19:54189505-54189527 GGCGGGCAGGGAAGAAGCCCCGG 0: 1
1: 0
2: 5
3: 46
4: 481
1168110559_1168110575 16 Left 1168110559 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1168110575 19:54189492-54189514 GGTCAGGGCCCCGGGCGGGCAGG 0: 1
1: 0
2: 1
3: 51
4: 528
1168110559_1168110574 12 Left 1168110559 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1168110574 19:54189488-54189510 CCACGGTCAGGGCCCCGGGCGGG 0: 1
1: 0
2: 4
3: 23
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168110559 Original CRISPR CCTGATCTGCGCAGCCCGGC GGG (reversed) Exonic