ID: 1168110561

View in Genome Browser
Species Human (GRCh38)
Location 19:54189454-54189476
Sequence GCCTGATCTGCGCAGCCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 89}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168110561_1168110576 16 Left 1168110561 19:54189454-54189476 CCGCCGGGCTGCGCAGATCAGGC 0: 1
1: 0
2: 2
3: 1
4: 89
Right 1168110576 19:54189493-54189515 GTCAGGGCCCCGGGCGGGCAGGG 0: 1
1: 0
2: 1
3: 22
4: 361
1168110561_1168110570 6 Left 1168110561 19:54189454-54189476 CCGCCGGGCTGCGCAGATCAGGC 0: 1
1: 0
2: 2
3: 1
4: 89
Right 1168110570 19:54189483-54189505 AGAAGCCACGGTCAGGGCCCCGG 0: 1
1: 0
2: 0
3: 25
4: 247
1168110561_1168110569 0 Left 1168110561 19:54189454-54189476 CCGCCGGGCTGCGCAGATCAGGC 0: 1
1: 0
2: 2
3: 1
4: 89
Right 1168110569 19:54189477-54189499 CGGGGAAGAAGCCACGGTCAGGG 0: 1
1: 0
2: 1
3: 14
4: 133
1168110561_1168110580 28 Left 1168110561 19:54189454-54189476 CCGCCGGGCTGCGCAGATCAGGC 0: 1
1: 0
2: 2
3: 1
4: 89
Right 1168110580 19:54189505-54189527 GGCGGGCAGGGAAGAAGCCCCGG 0: 1
1: 0
2: 5
3: 46
4: 481
1168110561_1168110575 15 Left 1168110561 19:54189454-54189476 CCGCCGGGCTGCGCAGATCAGGC 0: 1
1: 0
2: 2
3: 1
4: 89
Right 1168110575 19:54189492-54189514 GGTCAGGGCCCCGGGCGGGCAGG 0: 1
1: 0
2: 1
3: 51
4: 528
1168110561_1168110572 10 Left 1168110561 19:54189454-54189476 CCGCCGGGCTGCGCAGATCAGGC 0: 1
1: 0
2: 2
3: 1
4: 89
Right 1168110572 19:54189487-54189509 GCCACGGTCAGGGCCCCGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 210
1168110561_1168110574 11 Left 1168110561 19:54189454-54189476 CCGCCGGGCTGCGCAGATCAGGC 0: 1
1: 0
2: 2
3: 1
4: 89
Right 1168110574 19:54189488-54189510 CCACGGTCAGGGCCCCGGGCGGG 0: 1
1: 0
2: 4
3: 23
4: 262
1168110561_1168110566 -6 Left 1168110561 19:54189454-54189476 CCGCCGGGCTGCGCAGATCAGGC 0: 1
1: 0
2: 2
3: 1
4: 89
Right 1168110566 19:54189471-54189493 TCAGGCCGGGGAAGAAGCCACGG 0: 1
1: 0
2: 1
3: 22
4: 324
1168110561_1168110571 7 Left 1168110561 19:54189454-54189476 CCGCCGGGCTGCGCAGATCAGGC 0: 1
1: 0
2: 2
3: 1
4: 89
Right 1168110571 19:54189484-54189506 GAAGCCACGGTCAGGGCCCCGGG 0: 1
1: 0
2: 1
3: 14
4: 252
1168110561_1168110568 -1 Left 1168110561 19:54189454-54189476 CCGCCGGGCTGCGCAGATCAGGC 0: 1
1: 0
2: 2
3: 1
4: 89
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168110561 Original CRISPR GCCTGATCTGCGCAGCCCGG CGG (reversed) Exonic