ID: 1168110564

View in Genome Browser
Species Human (GRCh38)
Location 19:54189458-54189480
Sequence CGGGCTGCGCAGATCAGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168110541_1168110564 28 Left 1168110541 19:54189407-54189429 CCTCCCCCGCCCAGCGCGCCCCC 0: 1
1: 1
2: 26
3: 222
4: 1693
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110550_1168110564 8 Left 1168110550 19:54189427-54189449 CCCGCGCCGCCTGCTCCTTCTGG 0: 1
1: 0
2: 6
3: 36
4: 388
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110545_1168110564 22 Left 1168110545 19:54189413-54189435 CCGCCCAGCGCGCCCCCGCGCCG 0: 1
1: 0
2: 6
3: 69
4: 507
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110554_1168110564 2 Left 1168110554 19:54189433-54189455 CCGCCTGCTCCTTCTGGGCGCCC 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110558_1168110564 -7 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110548_1168110564 10 Left 1168110548 19:54189425-54189447 CCCCCGCGCCGCCTGCTCCTTCT 0: 1
1: 0
2: 3
3: 32
4: 428
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110552_1168110564 7 Left 1168110552 19:54189428-54189450 CCGCGCCGCCTGCTCCTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 283
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110542_1168110564 25 Left 1168110542 19:54189410-54189432 CCCCCGCCCAGCGCGCCCCCGCG 0: 1
1: 0
2: 8
3: 81
4: 820
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110549_1168110564 9 Left 1168110549 19:54189426-54189448 CCCCGCGCCGCCTGCTCCTTCTG 0: 1
1: 0
2: 1
3: 24
4: 287
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110555_1168110564 -1 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110547_1168110564 18 Left 1168110547 19:54189417-54189439 CCAGCGCGCCCCCGCGCCGCCTG 0: 1
1: 0
2: 5
3: 68
4: 506
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110546_1168110564 19 Left 1168110546 19:54189416-54189438 CCCAGCGCGCCCCCGCGCCGCCT 0: 1
1: 0
2: 5
3: 43
4: 380
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110544_1168110564 23 Left 1168110544 19:54189412-54189434 CCCGCCCAGCGCGCCCCCGCGCC 0: 1
1: 3
2: 15
3: 120
4: 825
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1168110543_1168110564 24 Left 1168110543 19:54189411-54189433 CCCCGCCCAGCGCGCCCCCGCGC 0: 1
1: 0
2: 14
3: 108
4: 721
Right 1168110564 19:54189458-54189480 CGGGCTGCGCAGATCAGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168110564 Original CRISPR CGGGCTGCGCAGATCAGGCC GGG Exonic