ID: 1168110568

View in Genome Browser
Species Human (GRCh38)
Location 19:54189476-54189498
Sequence CCGGGGAAGAAGCCACGGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168110549_1168110568 27 Left 1168110549 19:54189426-54189448 CCCCGCGCCGCCTGCTCCTTCTG 0: 1
1: 0
2: 1
3: 24
4: 287
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110550_1168110568 26 Left 1168110550 19:54189427-54189449 CCCGCGCCGCCTGCTCCTTCTGG 0: 1
1: 0
2: 6
3: 36
4: 388
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110558_1168110568 11 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110559_1168110568 0 Left 1168110559 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110561_1168110568 -1 Left 1168110561 19:54189454-54189476 CCGCCGGGCTGCGCAGATCAGGC 0: 1
1: 0
2: 2
3: 1
4: 89
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110562_1168110568 -4 Left 1168110562 19:54189457-54189479 CCGGGCTGCGCAGATCAGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110554_1168110568 20 Left 1168110554 19:54189433-54189455 CCGCCTGCTCCTTCTGGGCGCCC 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110552_1168110568 25 Left 1168110552 19:54189428-54189450 CCGCGCCGCCTGCTCCTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 283
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110555_1168110568 17 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110548_1168110568 28 Left 1168110548 19:54189425-54189447 CCCCCGCGCCGCCTGCTCCTTCT 0: 1
1: 0
2: 3
3: 32
4: 428
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168110568 Original CRISPR CCGGGGAAGAAGCCACGGTC AGG Exonic