ID: 1168110568

View in Genome Browser
Species Human (GRCh38)
Location 19:54189476-54189498
Sequence CCGGGGAAGAAGCCACGGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168110554_1168110568 20 Left 1168110554 19:54189433-54189455 CCGCCTGCTCCTTCTGGGCGCCC 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110555_1168110568 17 Left 1168110555 19:54189436-54189458 CCTGCTCCTTCTGGGCGCCCGCC 0: 1
1: 0
2: 1
3: 22
4: 238
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110562_1168110568 -4 Left 1168110562 19:54189457-54189479 CCGGGCTGCGCAGATCAGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110548_1168110568 28 Left 1168110548 19:54189425-54189447 CCCCCGCGCCGCCTGCTCCTTCT 0: 1
1: 0
2: 3
3: 32
4: 428
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110552_1168110568 25 Left 1168110552 19:54189428-54189450 CCGCGCCGCCTGCTCCTTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 283
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110559_1168110568 0 Left 1168110559 19:54189453-54189475 CCCGCCGGGCTGCGCAGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110550_1168110568 26 Left 1168110550 19:54189427-54189449 CCCGCGCCGCCTGCTCCTTCTGG 0: 1
1: 0
2: 6
3: 36
4: 388
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110558_1168110568 11 Left 1168110558 19:54189442-54189464 CCTTCTGGGCGCCCGCCGGGCTG 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110549_1168110568 27 Left 1168110549 19:54189426-54189448 CCCCGCGCCGCCTGCTCCTTCTG 0: 1
1: 0
2: 1
3: 24
4: 287
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
1168110561_1168110568 -1 Left 1168110561 19:54189454-54189476 CCGCCGGGCTGCGCAGATCAGGC 0: 1
1: 0
2: 2
3: 1
4: 89
Right 1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168110568 Original CRISPR CCGGGGAAGAAGCCACGGTC AGG Exonic
900163595 1:1236001-1236023 CCTGGGAAAAAGCCACTGTGTGG + Intergenic
901138718 1:7014164-7014186 CCGTGGCAGAAGCCACAGCCTGG + Intronic
901487037 1:9571222-9571244 CCGGGGAAGAAGTCCCGCTATGG - Intronic
902230777 1:15026114-15026136 CCGGGGAAGAGACCCAGGTCAGG - Intronic
903804303 1:25993409-25993431 CCAGGGAAGACACCAAGGTCCGG + Intronic
905232562 1:36523348-36523370 GCTATGAAGAAGCCACGGTCAGG - Intergenic
912632461 1:111257471-111257493 CTGGGGAAAAAGCCAAGGCCAGG - Intergenic
915196804 1:154195546-154195568 TGGGGGAAGAGGCCAAGGTCAGG + Intergenic
1063449724 10:6143355-6143377 ACGGGGAGGAAGCCACTGTCGGG - Intergenic
1064645405 10:17454437-17454459 GCGGAGAAGAAGCCGCGTTCGGG + Intergenic
1067094813 10:43293436-43293458 ACGAGGAAGAAGCCAGCGTCTGG - Intergenic
1070788800 10:79177578-79177600 CCGGGGCAGGAGGCAGGGTCCGG - Intronic
1071119857 10:82264677-82264699 CAGGGAAAGAAGCCACAGGCAGG + Intronic
1071797435 10:89021553-89021575 CCAGGGAAGGAGCAAGGGTCAGG - Intergenic
1073378314 10:103056416-103056438 CAAAGGAAGAAGCCAAGGTCAGG - Intronic
1074853005 10:117453939-117453961 CAGGGAAAGAACCCAAGGTCTGG + Intergenic
1076235147 10:128858279-128858301 CTGCTGAAGAAGCCAGGGTCAGG + Intergenic
1077100116 11:818955-818977 CCAGGTAAGAAGCCAAGGTCCGG + Exonic
1077148398 11:1056216-1056238 CCGTGGACGAAGCCATGGGCAGG - Intergenic
1077205095 11:1338242-1338264 CTGGGGAAGAGGCCAGGGCCCGG - Intergenic
1078104063 11:8347521-8347543 CTGAGGAAGCAGCCACTGTCTGG + Intergenic
1083182037 11:60993075-60993097 GCTGGAAAGAAGGCACGGTCTGG + Intronic
1084256604 11:67947081-67947103 CCGGGGCAGGAGCCAGGGCCAGG - Intergenic
1091410347 12:235071-235093 CCAGGTAAGAAGCCACAGACAGG - Exonic
1092426819 12:8381781-8381803 CCGGGGCAGGAGCCAGGGCCAGG - Intergenic
1103518960 12:121525077-121525099 CGGTGAAAGAAGCCAGGGTCCGG - Intronic
1105620904 13:22065146-22065168 CTGGGGAAGGAGCCAGGGTGAGG + Intergenic
1117956568 14:61127968-61127990 CCCGGGAAGAAGCTACAGGCTGG + Intergenic
1118293848 14:64550358-64550380 CGGGGGAAGCAGCCCCGCTCTGG + Intronic
1128934022 15:71730277-71730299 CCGTGCAAGGAGACACGGTCGGG - Intronic
1129148743 15:73673352-73673374 CTTGGGAAGGAGCCAGGGTCTGG + Intergenic
1129461224 15:75700954-75700976 CCAGGGCAGAAGCCTGGGTCAGG + Intronic
1132665109 16:1078006-1078028 CCGGAGGAGAAGCCGCGGTGGGG - Intergenic
1132684082 16:1154961-1154983 CCGGAGCAGAAGCCACGGCCTGG - Intronic
1132893400 16:2215360-2215382 CCGGGGAAGGAGCCCCGGGCTGG - Intergenic
1136274375 16:29169818-29169840 CCCGGGAAGCAGCCACAGGCTGG - Intergenic
1136998311 16:35207082-35207104 CCTGGGAAGCAGCCTGGGTCGGG + Intergenic
1137671487 16:50282031-50282053 CCAGGGAAGAGGCCCCGCTCAGG - Intronic
1138497947 16:57419648-57419670 CAGGGGAAGCAGCCCGGGTCTGG - Intergenic
1141504443 16:84465363-84465385 CCTGGGAAGAAGCCCCTCTCTGG + Intergenic
1141733839 16:85839610-85839632 TGGGGAAAGAAGACACGGTCAGG + Intergenic
1142078656 16:88135464-88135486 CCCGGGAAGCAGCCACGGGCTGG - Intergenic
1143290268 17:5822915-5822937 CAGTGGAAGAACACACGGTCAGG - Intronic
1146533360 17:33629204-33629226 GCAGGGAAGAAGCCACGGGGAGG - Intronic
1148231908 17:45941467-45941489 CTGGGGTAGAAGCCAGGGGCAGG - Intronic
1148568224 17:48646425-48646447 CCCGGGAAGCTGCCTCGGTCTGG + Intergenic
1151745997 17:76012093-76012115 CCAGGGAAGAACCCAGAGTCAGG + Intronic
1152828025 17:82479642-82479664 CCGGGGAAGCAGCCATGTCCAGG + Intronic
1157498192 18:48171227-48171249 TCGGGGAAGAAGCCACAAGCTGG - Intronic
1161716310 19:5877932-5877954 CCGGGGGTGAGGCCAGGGTCAGG - Intronic
1162569847 19:11465593-11465615 CCCTGGAGGAAGCCAGGGTCGGG - Intronic
1162604170 19:11694446-11694468 GCGTGGAAGGAGCTACGGTCCGG - Intergenic
1166727409 19:45037434-45037456 CCAGAGAAGAAGTCAGGGTCTGG - Exonic
1167136752 19:47620975-47620997 CCAGGGAGGCAGCCAGGGTCAGG - Intronic
1167573464 19:50305350-50305372 CAGGGGAAGAAGACACTGTTTGG + Intronic
1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG + Exonic
1168346956 19:55654635-55654657 CCGTGGAAGAAGCCAAAGACTGG + Intronic
1168608240 19:57776868-57776890 CCAGGGAAGGAGTCAGGGTCAGG + Intronic
925578084 2:5381179-5381201 CTGGGGAAGAATCCACTTTCAGG + Intergenic
926092531 2:10060061-10060083 CAGGGCATGAAGCCTCGGTCAGG + Intronic
926292388 2:11541278-11541300 CCGGGCAGGAAGCCAGGGTTGGG + Intronic
928016687 2:27664166-27664188 CAGGGGAAGAAACCGCTGTCGGG - Exonic
932345773 2:70994488-70994510 ACCTGGAAGGAGCCACGGTCAGG + Intronic
933718159 2:85377249-85377271 CCTGGGAAGAGGCCAGTGTCAGG + Intronic
937705135 2:124911886-124911908 TCGGGGAAGAAGCCATGTTGGGG + Intronic
946853786 2:223933254-223933276 CCAGGGAAGAAGCCACTGGGTGG + Intronic
948024371 2:234765113-234765135 CTGGGGGAGAAGCAGCGGTCAGG + Intergenic
948824594 2:240568239-240568261 CCGGGGAGGAAGCGAGGGGCTGG + Intronic
1170760965 20:19251336-19251358 CTGTGGAAGAAGCCACAGACAGG + Intronic
1175418833 20:58818550-58818572 CCGGGGAAGGAACAACGGTGAGG + Intergenic
1179244214 21:39616479-39616501 CAAGTGAAGAAGCCACAGTCTGG - Intronic
1179431356 21:41323333-41323355 CAGGGGAGGAAGCCAAGATCTGG - Intronic
1180180959 21:46118524-46118546 CGGGGGCAGGACCCACGGTCGGG - Intronic
950434821 3:12973126-12973148 CCGGGCCAGAAGCCTAGGTCAGG - Intronic
953770861 3:45777825-45777847 CCTGGGAAGCAGGCCCGGTCTGG - Intronic
961057282 3:123799832-123799854 CCGAGGAAGAAGCTGCGGTAAGG - Intronic
961282622 3:125775644-125775666 CCGGGGCAGGAGCCAGGGCCAGG + Intergenic
964801574 3:160564849-160564871 CCGGGGAAGGGGCCGCGGCCCGG + Intronic
969015114 4:4098788-4098810 CCAGGGCAGAAGCCAGGGCCAGG - Intergenic
969738820 4:9009496-9009518 CCGGGGCAGGAGCCAGGGCCAGG + Intergenic
969900549 4:10345199-10345221 CCAGGGAGGAACCCAGGGTCAGG - Intergenic
976086074 4:81408492-81408514 CCTGGGAAATAGCCACGGTGGGG + Intergenic
976625150 4:87172318-87172340 CTGGGGAAGAAGCCACTTCCAGG - Intronic
984814882 4:183826671-183826693 GCGGGGCAGATTCCACGGTCGGG - Intergenic
996318075 5:122183583-122183605 CCTGGGAGGACGCCAGGGTCAGG + Intergenic
1000296732 5:159918734-159918756 CTAAGGAAGAAGCCAAGGTCTGG + Intronic
1002616937 5:180461783-180461805 CCTGGGAAGAAGCTGCTGTCAGG - Intergenic
1002858444 6:1058433-1058455 CCAGGGAAGAAGGCACTGTGGGG + Intergenic
1003508964 6:6763450-6763472 CCCGGGAAGAAGCAAGGGACAGG + Intergenic
1005741581 6:28795944-28795966 CCGGGGAAGAAAACACGGCCTGG + Intergenic
1006929270 6:37678001-37678023 CCTGGGTAGAAGCCAAGGCCTGG - Intronic
1010007251 6:71009896-71009918 CTGGGGAAGAAGGCATGCTCTGG + Intergenic
1012549645 6:100455331-100455353 CCGGGGAGGAAACCTCGGGCGGG - Intronic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1015368556 6:132425145-132425167 CCTGGGAAGAAGCCCCTGGCAGG - Intergenic
1019334587 7:476978-477000 CAGGTGAAGCAGCCACGGGCAGG - Intergenic
1019383555 7:740749-740771 CCGGGGCTGACGCCACGGTGCGG - Intronic
1023981476 7:45073166-45073188 CAGGGGAAGGAGCCAGGGTTGGG - Intronic
1029073783 7:97920411-97920433 CCGGGGCAGGAGCCAGGGCCGGG - Intergenic
1029216808 7:98956470-98956492 CCTGGGCAGAATCCACGGACAGG - Exonic
1033715068 7:143992242-143992264 CCGGGAAAGAAGCCAAAGTATGG + Intergenic
1036256883 8:7213203-7213225 CCGGGGCAGGAGCCAGGGCCAGG - Intergenic
1036308933 8:7671802-7671824 CCGGGGCAGGAGCCAGGGCCAGG - Intergenic
1036360605 8:8074310-8074332 CCGGGGCAGGAGCCAGGGCCAGG + Intergenic
1036890366 8:12592657-12592679 CCGGGGCAGGAGCCAGGGCCAGG - Intergenic
1036897934 8:12650574-12650596 CCGGGGCAGGAGCCAGGGCCAGG - Intergenic
1037585280 8:20271668-20271690 CTGGTGAAGCAGCCGCGGTCAGG - Intronic
1046770502 8:118112176-118112198 CCGGGGAAGGAGGCACCGGCAGG + Intergenic
1049542293 8:143214136-143214158 CAGGGGAAGAAGCCACCAGCTGG + Intergenic
1058836297 9:108861149-108861171 CTGGGGAGGAAGCCACAGTCAGG + Intergenic
1061923671 9:133795627-133795649 GCAGGGGAGAAGCCACCGTCTGG - Intronic
1062168400 9:135120495-135120517 CCGGGGAAAAACCCACTGTTAGG + Exonic
1187235874 X:17466633-17466655 CTGGGGCAGAAGCCACTGCCAGG + Intronic
1189143729 X:38634894-38634916 CCTGATAAGAAGCCATGGTCAGG + Intronic
1194776327 X:97969449-97969471 CCGGGAAAGATTCCACCGTCTGG + Intergenic
1200408828 Y:2841850-2841872 CCGGGTAAAAAGCCACTGCCGGG - Intronic