ID: 1168110866

View in Genome Browser
Species Human (GRCh38)
Location 19:54190705-54190727
Sequence GGGCGGGGCTGCGGATTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168110853_1168110866 18 Left 1168110853 19:54190664-54190686 CCGAGAACACCCGAACGTCAAAT 0: 1
1: 0
2: 1
3: 2
4: 43
Right 1168110866 19:54190705-54190727 GGGCGGGGCTGCGGATTCGGTGG 0: 1
1: 0
2: 3
3: 20
4: 212
1168110856_1168110866 8 Left 1168110856 19:54190674-54190696 CCGAACGTCAAATTGCTGGCGTT 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1168110866 19:54190705-54190727 GGGCGGGGCTGCGGATTCGGTGG 0: 1
1: 0
2: 3
3: 20
4: 212
1168110855_1168110866 9 Left 1168110855 19:54190673-54190695 CCCGAACGTCAAATTGCTGGCGT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1168110866 19:54190705-54190727 GGGCGGGGCTGCGGATTCGGTGG 0: 1
1: 0
2: 3
3: 20
4: 212
1168110852_1168110866 23 Left 1168110852 19:54190659-54190681 CCGAGCCGAGAACACCCGAACGT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1168110866 19:54190705-54190727 GGGCGGGGCTGCGGATTCGGTGG 0: 1
1: 0
2: 3
3: 20
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168110866 Original CRISPR GGGCGGGGCTGCGGATTCGG TGG Intronic
900145550 1:1157461-1157483 GGGCGGGGCTGCGGGCGGGGCGG - Intergenic
900435574 1:2629159-2629181 GGGCCGAGCTGCGGACTCAGAGG - Intronic
901049605 1:6419735-6419757 GGGCGGGGCTGGGGACTCCGGGG - Intronic
903703491 1:25267940-25267962 GGGCGGGGCGCCGGGTCCGGAGG - Intronic
903712758 1:25338269-25338291 GGGCGGGGCGCCGGGTCCGGAGG - Exonic
904162285 1:28530708-28530730 GCCCGGGGCTGCGGGTTGGGGGG + Intronic
904831196 1:33307637-33307659 GGGTGGGGGTGAGGATTGGGTGG - Intronic
907053463 1:51344963-51344985 GGGCAGGGGTGGGGACTCGGCGG - Intronic
909475243 1:76074680-76074702 GGGCGGGGCCGCGGCTCGGGGGG + Intergenic
910462588 1:87464425-87464447 GAGGGGGGCTGCGGGTTGGGAGG + Intergenic
911399181 1:97353312-97353334 GGGCAGGGCTGCGGAATGGCAGG + Intronic
911527544 1:99004758-99004780 GGGCGCGGCGGCGGAGGCGGCGG + Exonic
912800838 1:112718962-112718984 GGGCGAGGCGGCGGTTGCGGCGG + Intergenic
914679315 1:149927851-149927873 GGGCGGGGCCGCGGAAGAGGAGG + Exonic
915059796 1:153171912-153171934 GTACAGGGCTGGGGATTCGGGGG - Intergenic
916599311 1:166276630-166276652 GGGCGGGGAGGAGGATGCGGTGG - Intergenic
918511396 1:185317387-185317409 GGGCGGGGCCGCGGGTGGGGCGG - Intergenic
919097975 1:193059736-193059758 TGGCGGCGCTGCGGATCCAGGGG + Intronic
920511858 1:206557510-206557532 GGGCCGGGCTTGGGATGCGGCGG - Intronic
920802654 1:209203770-209203792 TGGCGGGGGGGCGGATTTGGGGG + Intergenic
921923087 1:220690301-220690323 GGACGGGGCGGGGGATTGGGGGG - Exonic
922748385 1:228059757-228059779 AGGCGGGGCTACAGATTGGGCGG + Exonic
924686469 1:246296187-246296209 GGGCGTGACTGAGGCTTCGGTGG - Intronic
1064645379 10:17454348-17454370 GCGCGGGGCTGCGGCCACGGCGG - Intergenic
1067091133 10:43266449-43266471 GGTGGGGGCTGGGGAATCGGAGG - Intronic
1069438519 10:68407267-68407289 GGGCCTGGCTGCAGATGCGGTGG - Intronic
1069691894 10:70359186-70359208 GGGCGGGGCTGGGGTTTGGAGGG - Intronic
1072102309 10:92240240-92240262 GGACGGGGCTTCGGATACGCTGG + Exonic
1075784343 10:125038774-125038796 GGGCGGGGTTGGGGACTAGGAGG - Intronic
1076200999 10:128557797-128557819 GGGCTGGGCTGTGGATGCTGAGG + Intergenic
1077008294 11:369333-369355 GGGCGGGGCGGGGGGTGCGGAGG - Intergenic
1077052939 11:575927-575949 GGGCGGGGCTGCGGAGCAGCGGG + Intergenic
1077052969 11:576005-576027 GGGCGGGGCTGCAGACGTGGGGG + Intergenic
1077052987 11:576049-576071 GGGCGGGGCTGCGGGGGTGGGGG + Intergenic
1077148034 11:1054546-1054568 GGGCGAGGCTGCGGGGTGGGTGG + Intergenic
1077328938 11:1975614-1975636 GGGCGGGGCTGGGGATCTGCAGG - Intronic
1077628814 11:3797238-3797260 GGGCGGTGCTGAGGACCCGGGGG - Intronic
1077898810 11:6473959-6473981 GGGCGGGGCTGCGGACCGGCCGG + Intronic
1079238514 11:18706325-18706347 GGACGGGGCTGGGGGGTCGGGGG - Intronic
1080540063 11:33257203-33257225 GGGCGCGGCTGCGGACTGGCGGG + Intronic
1083656944 11:64234476-64234498 GGGCGGGGCGGCGGGGTGGGGGG - Intergenic
1083740925 11:64711495-64711517 GGGCGGGGCTGTGGTGTCGGGGG - Intronic
1083778826 11:64907595-64907617 GGGCTGGGCGGCGGGGTCGGGGG + Exonic
1083842885 11:65314835-65314857 GGGCGGGGCTGCGGGGTCCGCGG + Exonic
1084412827 11:69013992-69014014 GGGTGGGGGTGCAGAGTCGGGGG + Intergenic
1085457383 11:76672706-76672728 GGGCGGGGCTGGGGCTATGGTGG + Intergenic
1089580290 11:119477351-119477373 GGGCGGGACTGTGGCTTCGCAGG + Intergenic
1091328572 11:134712612-134712634 GGGCGGGGCTGCGGAAGGGCGGG - Intergenic
1202811917 11_KI270721v1_random:30793-30815 GGGCGGGGCTGGGGATCTGCAGG - Intergenic
1096503929 12:52081266-52081288 GGGAGGGGCTCCAGAATCGGGGG - Intergenic
1097007186 12:55927820-55927842 GGGCGGCGCCGGGGATTCGGCGG + Exonic
1098372087 12:69770277-69770299 GGGTGGGGGGGCGGATTTGGAGG - Intronic
1102997457 12:117361245-117361267 GCGCGGGGCGGCGGACTCGGAGG - Intronic
1104376200 12:128267130-128267152 GGGCGGGCCGGCGGCTGCGGAGG + Intergenic
1105015378 12:132783492-132783514 GGGAGGGGCTGGGGAGTGGGGGG + Intronic
1106077815 13:26475956-26475978 GGGTGAGGCTGAGGCTTCGGGGG + Intergenic
1112486031 13:99820471-99820493 GGGTGGGGGTGGGGAGTCGGGGG - Intronic
1114620576 14:24094074-24094096 GGGCGGGGCCTCGAAGTCGGGGG + Intronic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1117912680 14:60649618-60649640 GGGCGAGGCTGCGGAGCTGGGGG + Intronic
1118316059 14:64726777-64726799 GGGTGGGGCTGCGGAGTCGGGGG + Intronic
1122371234 14:101230035-101230057 GGGCGAGGCTGCGGGGTGGGGGG - Intergenic
1122543144 14:102508943-102508965 GGTCGGGGCTGGGGACTCAGAGG - Intronic
1122631682 14:103110127-103110149 GGCCGGGGCGGCGGGTGCGGAGG + Exonic
1122645167 14:103189277-103189299 GGGCGGGGCTGGGGAGAGGGTGG - Intergenic
1126102833 15:45129963-45129985 GGGCGGGGCTGGGGGTGAGGAGG - Exonic
1128056475 15:64703240-64703262 GGGCGGGGCGGCGGCGGCGGCGG - Exonic
1128161044 15:65422971-65422993 GGGCGGGGGCGCGGCCTCGGGGG + Exonic
1128357038 15:66935354-66935376 GGGCGGGGCTGGTGAATCAGGGG - Intergenic
1128496423 15:68201021-68201043 GGTCTGGGCTGGGGATTTGGGGG - Intronic
1130010991 15:80152853-80152875 GGGCAGGGCTCGGGGTTCGGGGG + Exonic
1130018048 15:80202297-80202319 GGGTGGGGCTGAGGGTTGGGTGG + Intergenic
1130038909 15:80387171-80387193 GGGCGGGGGTGGGGAGTTGGGGG + Intronic
1130531135 15:84748549-84748571 GGGCGGGGCTGCGGCTCCGGGGG - Intergenic
1132552374 16:558931-558953 GGGCGGGGCAGGGGACTGGGAGG - Intergenic
1132569273 16:637085-637107 GGGCGGGGCTGGGGAGAGGGCGG + Intronic
1132734353 16:1378230-1378252 GGGCAGGCCTGCGGGTTGGGGGG - Intronic
1133031363 16:3012799-3012821 GTGCGGGGCTGGGGGTTCGTGGG - Exonic
1135109431 16:19679139-19679161 GGGCGGGGGTGGGGAGGCGGGGG + Intronic
1136378194 16:29877560-29877582 GGGCGGGGCTGGAGAGTAGGAGG - Intronic
1137244692 16:46692869-46692891 GGGCGGGGCGGCGGTGGCGGTGG + Intronic
1139623164 16:68163467-68163489 GGGCGGGGCTGCTGGCTGGGCGG + Intronic
1141490357 16:84368453-84368475 GGGCGGGGCTGCGCACAGGGAGG - Intergenic
1142173595 16:88634968-88634990 GGGCGGGGCGCAGGATGCGGGGG + Intergenic
1142699152 17:1649123-1649145 GGGCGGGGCTCCGGGGGCGGGGG - Intronic
1142986160 17:3696347-3696369 GGGCGGTCCTGCGCATCCGGGGG - Exonic
1143400647 17:6640203-6640225 GGTCGGGGCGGGGGGTTCGGCGG - Intronic
1144759764 17:17700687-17700709 GGGCCGGACTGCGGCCTCGGCGG - Intronic
1144775649 17:17783336-17783358 GGGCTGGGCTGCGGAGGCGGCGG + Intronic
1147155042 17:38540399-38540421 CGGCGGGGGTGGGGATTGGGGGG - Intronic
1147267679 17:39244635-39244657 GGGCAGGGCTGGGGATTGGTGGG + Intergenic
1147336635 17:39730310-39730332 GGGCTGGGCTGGGGATTCGGGGG + Intronic
1147742744 17:42678116-42678138 GGGCGGGGCCGCGGCCTCCGCGG + Intergenic
1147891539 17:43720836-43720858 GGGAGGGGCTGAGGATTTGGCGG - Intergenic
1147964554 17:44187190-44187212 GGGCGGGGCTGGGGAACTGGGGG - Intronic
1148108001 17:45129741-45129763 GGGCTGGGCTGCGGACTTGCAGG - Intronic
1148463487 17:47851194-47851216 GGGCGGGGCCGCGAGTCCGGGGG - Intronic
1148664099 17:49361921-49361943 GGCCGGGGCGGCGGAGGCGGAGG - Intronic
1148913517 17:50955898-50955920 AGGAGGGGCTGAGGATTAGGGGG - Intergenic
1149367775 17:55963039-55963061 GGGCAGGGCTGGGGATGGGGTGG - Intergenic
1151780005 17:76239812-76239834 GAGCGGGGCTGCGGCGTCGTAGG - Intronic
1152093709 17:78260636-78260658 CGGTGGGGCTGCTGATTCTGGGG + Intergenic
1152197337 17:78925304-78925326 GGGCGGGGCGGCGGGGTGGGGGG + Exonic
1152636525 17:81432692-81432714 GGGTGGGCCTGGGGATGCGGGGG - Intronic
1152782022 17:82230922-82230944 GGGCGCGGCTCGGGACTCGGGGG - Intronic
1153193776 18:2571117-2571139 GAGAGGGGCTGCGGAGTGGGTGG - Intronic
1153285152 18:3449993-3450015 GGGCGGCGGTGCGGACGCGGGGG - Intronic
1158434963 18:57428867-57428889 GGGCGGCGCTGCCGACTCGGAGG - Intergenic
1160722822 19:604807-604829 GGCGGGGGCTGTGGATTTGGGGG + Intronic
1160860881 19:1236853-1236875 GGGGGGGGCGGCGGCCTCGGGGG + Intronic
1160875871 19:1295958-1295980 GGGCGGGGCAGCGCAGTGGGCGG + Intronic
1160967319 19:1752502-1752524 GGTCAGGGCTGCGGATCTGGAGG - Exonic
1161038554 19:2098235-2098257 GGGCGGGGCCGTGGGTTCAGGGG + Intronic
1161234191 19:3189896-3189918 GGGCGGGGCTTCGGAATGGGAGG + Intronic
1161469361 19:4448567-4448589 GGGCAGGGCTGCGGTCTTGGAGG - Intronic
1161510015 19:4665058-4665080 GGGCGGGGCAGGGGATTTAGTGG - Intronic
1162079547 19:8209857-8209879 CGGCCGGGCTGCGGACTCCGAGG - Intronic
1162935330 19:13978997-13979019 GGCCGGGGCGGCGGCTCCGGCGG + Intronic
1163333988 19:16659904-16659926 GGGCGGGGCTACGGGTTCCCCGG + Intronic
1163441297 19:17323822-17323844 GCGCGGGGCTCCGGCTGCGGCGG + Exonic
1163466433 19:17470739-17470761 GGGCGGGGCTGAGGGCTCTGGGG + Intronic
1164120564 19:22261766-22261788 GGGCGGGGCGGGGGTGTCGGGGG + Intergenic
1164160494 19:22623104-22623126 GGGCGGGGCTGGGGTGTCGGGGG + Intergenic
1167633490 19:50639820-50639842 GCGCGGGGCTGCGGCGGCGGCGG - Intronic
1168110866 19:54190705-54190727 GGGCGGGGCTGCGGATTCGGTGG + Intronic
1168269327 19:55241168-55241190 GGACTGGGCTGAGGGTTCGGGGG - Intronic
925034636 2:676389-676411 GGGCGGGGCTGCAGCTTGGAGGG - Intronic
925034644 2:676414-676436 GGGCGGGGCTGCAGCTTGGAGGG - Intronic
927149805 2:20189070-20189092 GGGTGGGGCAGAGGATTAGGTGG - Intergenic
931602591 2:64019211-64019233 AGGCGGCGCTGCGGACCCGGGGG - Intergenic
936007864 2:108906490-108906512 GGGCTGGGCTGCTGACACGGGGG - Intronic
937280950 2:120716851-120716873 GGGCAGGGCGGCGGCTTCTGGGG + Intergenic
945806182 2:214492464-214492486 GGGCTGGACTGCTGATTTGGTGG - Intronic
946185489 2:217978547-217978569 GGGGCGGGCTGGGGAATCGGGGG - Intronic
947768392 2:232651966-232651988 GGGCAGAGCTGCGGGTTAGGGGG + Intronic
948806678 2:240456127-240456149 GGGCGGGGCTGAGGGGTCGGCGG + Intronic
949040073 2:241844019-241844041 GGGCGGCGCTGCAGGGTCGGGGG + Intergenic
1172214226 20:33223741-33223763 GTGGGGGGCTTGGGATTCGGAGG - Intronic
1173736145 20:45363107-45363129 GGGCGGGGCTGAGGTTGCGCAGG - Exonic
1174088175 20:48025178-48025200 GGGAGGGGCTGTGGTTTCAGAGG + Intergenic
1174475849 20:50795179-50795201 GGACGGGGCTGTGGAGTTGGAGG + Intronic
1175337802 20:58207302-58207324 GGGCCAGGCTGCGGATGCAGAGG - Intergenic
1176198011 20:63846498-63846520 AGGTGGGGCTGCGGATGTGGGGG + Intergenic
1178103972 21:29298756-29298778 GGGCGGGGCTTCGGCGCCGGGGG + Intronic
1180110067 21:45643425-45643447 GGGCGGGGCCGAGCATTGGGCGG - Intergenic
1180167081 21:46035885-46035907 GGGCAGGGCTGCGGCTCCCGGGG - Intergenic
1180216090 21:46324543-46324565 GGGCGGGGCTGCGCCTGCGTCGG + Intronic
1180842557 22:18966102-18966124 GGGTGGGGCTGGGGAGTAGGAGG - Intergenic
1180934424 22:19615385-19615407 GGACGGGGCTGCAGCTTCGACGG - Intergenic
1181270893 22:21657924-21657946 GGACGGGGCTGCGGAAGAGGAGG - Intronic
1181533126 22:23528437-23528459 GGGTGGGGCTGGGGTTTGGGGGG + Intergenic
1182604075 22:31489832-31489854 GGGCCGGGCTGCAGTTACGGCGG - Intronic
1182880869 22:33732275-33732297 GGGCGGGGCTGGGGAATCCCTGG + Intronic
1183221397 22:36515891-36515913 GGGCGGGGGGGCGGATTGGGAGG + Intronic
1183303258 22:37068975-37068997 GGGCGGGGCTGGGGGTCCCGGGG - Intronic
1183492262 22:38122939-38122961 GGGCGGGGCTGCAGGTGCTGAGG - Intronic
1183710801 22:39502200-39502222 AGGCGGGGCTCAGGATTGGGGGG + Intronic
1183727636 22:39598324-39598346 GGGCGGGGGTGTGGAGTGGGCGG - Intronic
1184162417 22:42704881-42704903 GGGGGGGGCGGCGGAGGCGGGGG + Intronic
1184647424 22:45903724-45903746 GGCCGAGGCTGCGGCTGCGGTGG - Intergenic
1185296760 22:50058445-50058467 AGGCGCGGCTGCGGGGTCGGCGG + Intergenic
954130478 3:48558249-48558271 AGGCGGGGCTGGGGATCCCGAGG - Intronic
954800268 3:53183222-53183244 GGGCAGGGCTGGGGATCTGGGGG + Intronic
961692663 3:128681153-128681175 ACGCGGGGCTGCGGAGGCGGCGG + Intergenic
964482792 3:157159619-157159641 GCGGGGGGCTGCGGAGGCGGAGG - Intronic
966696269 3:182793461-182793483 GGGCGGGGGTGGGGTTGCGGGGG + Intergenic
968648038 4:1749540-1749562 GGGCAGGGCTGGGGACTGGGAGG + Intergenic
969230365 4:5826430-5826452 GGGCAGGGCTGGGGATGCTGTGG + Intronic
978777047 4:112515259-112515281 CGGCGTGGCTGCGGGTGCGGAGG - Exonic
980405078 4:132344928-132344950 GGCCGGGGCTGCGGCTGGGGCGG + Intergenic
980930009 4:139176522-139176544 GGGCGGGGGTCCGGCTCCGGAGG - Intronic
983233433 4:165152425-165152447 GGGCGGGGGTGCGGATCACGAGG - Intronic
983620579 4:169757498-169757520 GTGGGGCGCTGCGGATTTGGGGG - Intronic
984756227 4:183328085-183328107 GGGCTTGGCTGAGGATTCTGAGG - Intergenic
985489027 5:168276-168298 GGGTGGGGCTGAGGGTTCCGTGG + Intronic
985746900 5:1652925-1652947 GGGCGTGGCTGAGGCTTGGGCGG + Intergenic
985827682 5:2204999-2205021 GGGTGGGGCTGGGGCTTGGGCGG + Intergenic
985896565 5:2752477-2752499 GGGTTGCGCTGCGGATTTGGGGG - Intronic
986190833 5:5494859-5494881 AGGCGGGGCTGTGGGTTCGGAGG - Intergenic
986190840 5:5494879-5494901 GGGCGGGGTTGCAGAGTCGGAGG - Intergenic
986402799 5:7396088-7396110 GGGCCGGGCGGCGGCCTCGGGGG - Intergenic
992590808 5:78294396-78294418 GGGAGGAGCTGCGGACTCGGAGG - Intronic
992813120 5:80408517-80408539 GGGAGGGGCTGCGACTGCGGAGG + Intronic
992962789 5:81972270-81972292 GGGCTGGGCTGCGGGGTCAGGGG + Exonic
996862652 5:128083708-128083730 CGGCGGGGCTGCGGCGGCGGCGG - Intergenic
1003098098 6:3157609-3157631 GGGCGGGGCTGTGGCCGCGGGGG + Intergenic
1003212337 6:4079105-4079127 GGCCGGGGCTGCGGCTCCGCGGG + Exonic
1006477154 6:34263685-34263707 GGGCGGCGCGGCGGCGTCGGCGG - Intergenic
1006516152 6:34546805-34546827 AGGCGGGGCTGGGGATGTGGGGG + Intronic
1007400224 6:41599000-41599022 GGGAGGGGCTGTGGAGTTGGGGG - Exonic
1007586043 6:42990055-42990077 GGGTGGGGCAGGGGATTGGGAGG + Intronic
1011127162 6:84019642-84019664 GGGCGAGGCGGTGGGTTCGGGGG + Intergenic
1013272561 6:108558118-108558140 CGGCGGGGCTGGGGGCTCGGGGG - Intergenic
1013978210 6:116100812-116100834 GGGCGGGGCTGCGGCTGCCAGGG - Intergenic
1018769362 6:166957470-166957492 GGGCGGGGCCGCGGGTGCAGGGG - Intergenic
1018839233 6:167506848-167506870 GGGAGGGGCTGCGGCTTCTGGGG + Intergenic
1019298258 7:290287-290309 GGGCGGTGCTGGGGCTTTGGGGG + Intergenic
1019429117 7:990616-990638 GGGTGGGGCTGCTGCTACGGAGG + Intergenic
1019504593 7:1384345-1384367 GGGCAGGGGTGCAGATTCTGAGG + Intergenic
1019731505 7:2631919-2631941 GGGCGGGGGTGCGGAGGGGGCGG + Intergenic
1022701349 7:32763037-32763059 GGGCGGGCCTGCGGGTCCGTTGG - Intergenic
1022973500 7:35537321-35537343 GGGCGGGGGGGCGGAGTTGGGGG + Intergenic
1024197500 7:47073438-47073460 GGGAGGGGCTGCTGTGTCGGGGG + Intergenic
1027001487 7:74657608-74657630 GGGCGGCGCTGCGGATGCGCAGG + Intergenic
1029444328 7:100604258-100604280 GGGCGGGGCTGCGGCCGGGGCGG - Intronic
1034331633 7:150288137-150288159 GGCCAGGGCAGCTGATTCGGAGG + Intronic
1034441154 7:151086686-151086708 GGGCGGCGCGGCGGAGGCGGCGG - Intronic
1034963635 7:155377994-155378016 GCGCGGGGCTGGGGCTTCCGGGG - Intergenic
1035221528 7:157409300-157409322 GGGCGGGGCTGTGGCTCCCGTGG + Intronic
1036733226 8:11284509-11284531 GGGCGTGGAAGCGGATTCTGAGG + Exonic
1038502632 8:28058635-28058657 GGTAGGGGCTGTGGATTCAGAGG - Intronic
1045035435 8:98173148-98173170 GGGCGGGGCGGCGGGTTGTGTGG + Intergenic
1047381723 8:124371574-124371596 GGCCGAAGCTCCGGATTCGGAGG + Intronic
1047732381 8:127737718-127737740 GGGAGGGGCTGCGGTGCCGGCGG + Intronic
1049453892 8:142677295-142677317 TGCTGGGGCTGCGGATTCTGTGG + Intronic
1049606417 8:143531365-143531387 GGGCGGGGCAGGGGATTCCTGGG - Intronic
1052994895 9:34546721-34546743 GGGAGGGGCTGAGGATGGGGAGG - Intergenic
1053009364 9:34624622-34624644 GGCGCGGGCTGCGGAGTCGGCGG - Intronic
1055321675 9:75088500-75088522 GGGCGGGGCGGAGCACTCGGCGG + Intergenic
1056532477 9:87498779-87498801 GCGCGGGGCTGAGGGGTCGGGGG + Intronic
1056654517 9:88498122-88498144 GGGCGGGGGTGCACTTTCGGAGG - Intergenic
1057441326 9:95085861-95085883 GGGCGGGGCGGGGCTTTCGGAGG + Intronic
1057488542 9:95505855-95505877 GCGCGGGGCTGCGGAGGCGGCGG - Intronic
1058426051 9:104876112-104876134 GGGCAGGGCTGTGGATTCTATGG - Intronic
1059452081 9:114376836-114376858 GGCCTGGGCTGGGGATTCAGGGG + Exonic
1060816464 9:126637993-126638015 GGGCAGGGCTGCGGAGCGGGAGG - Intronic
1062432247 9:136531439-136531461 GGGTGGGGCTGGGGGTGCGGGGG - Intronic
1062483144 9:136761794-136761816 GGGCGGGGGTGGGGCTCCGGAGG + Exonic
1062567313 9:137168955-137168977 GGGCGGCGGTGCGGAGGCGGCGG + Exonic
1203785215 EBV:123774-123796 GGGCGGGTGTGTGGAGTCGGGGG + Intergenic
1186871930 X:13782023-13782045 GGGCAGGGCTGAGGATGCTGGGG - Intronic
1190321844 X:49184411-49184433 GGGCGGGGCTGCGTAGTGGGTGG + Intronic
1190789663 X:53686768-53686790 GGGCGGGGCTTCGCTTGCGGTGG - Intergenic
1195269450 X:103215527-103215549 GGGCGGGGCGGCTGAGGCGGGGG + Intronic
1195923318 X:110003026-110003048 GGGTGGAGCTGGGGGTTCGGGGG + Intronic
1199760155 X:150898805-150898827 GGGCGAGGCTGCAGTATCGGGGG + Intronic