ID: 1168112054

View in Genome Browser
Species Human (GRCh38)
Location 19:54198386-54198408
Sequence CTGTAACCCCAGGTGGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168112054_1168112060 -3 Left 1168112054 19:54198386-54198408 CCAAATCCCACCTGGGGTTACAG No data
Right 1168112060 19:54198406-54198428 CAGGTGTGAGCCACGGTGCCTGG 0: 184
1: 12499
2: 51081
3: 121296
4: 147295
1168112054_1168112065 18 Left 1168112054 19:54198386-54198408 CCAAATCCCACCTGGGGTTACAG No data
Right 1168112065 19:54198427-54198449 GGCCTAGTAGTTAAGTTTTGGGG No data
1168112054_1168112064 17 Left 1168112054 19:54198386-54198408 CCAAATCCCACCTGGGGTTACAG No data
Right 1168112064 19:54198426-54198448 TGGCCTAGTAGTTAAGTTTTGGG No data
1168112054_1168112063 16 Left 1168112054 19:54198386-54198408 CCAAATCCCACCTGGGGTTACAG No data
Right 1168112063 19:54198425-54198447 CTGGCCTAGTAGTTAAGTTTTGG No data
1168112054_1168112059 -10 Left 1168112054 19:54198386-54198408 CCAAATCCCACCTGGGGTTACAG No data
Right 1168112059 19:54198399-54198421 GGGGTTACAGGTGTGAGCCACGG 0: 35
1: 1510
2: 4169
3: 5215
4: 4074

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168112054 Original CRISPR CTGTAACCCCAGGTGGGATT TGG (reversed) Intergenic
No off target data available for this crispr