ID: 1168112463

View in Genome Browser
Species Human (GRCh38)
Location 19:54201229-54201251
Sequence ATTTCTCGAAGGGTCTCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 2, 1: 0, 2: 2, 3: 4, 4: 36}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168112463_1168112470 21 Left 1168112463 19:54201229-54201251 CCCGCGGAGACCCTTCGAGAAAT 0: 2
1: 0
2: 2
3: 4
4: 36
Right 1168112470 19:54201273-54201295 AGCTGATCGGTGAGTGGCCAAGG 0: 1
1: 0
2: 0
3: 8
4: 118
1168112463_1168112471 28 Left 1168112463 19:54201229-54201251 CCCGCGGAGACCCTTCGAGAAAT 0: 2
1: 0
2: 2
3: 4
4: 36
Right 1168112471 19:54201280-54201302 CGGTGAGTGGCCAAGGCTTCCGG 0: 1
1: 0
2: 2
3: 10
4: 124
1168112463_1168112472 29 Left 1168112463 19:54201229-54201251 CCCGCGGAGACCCTTCGAGAAAT 0: 2
1: 0
2: 2
3: 4
4: 36
Right 1168112472 19:54201281-54201303 GGTGAGTGGCCAAGGCTTCCGGG 0: 1
1: 0
2: 1
3: 22
4: 235
1168112463_1168112467 8 Left 1168112463 19:54201229-54201251 CCCGCGGAGACCCTTCGAGAAAT 0: 2
1: 0
2: 2
3: 4
4: 36
Right 1168112467 19:54201260-54201282 GACCAAGAGCTGAAGCTGATCGG 0: 2
1: 0
2: 3
3: 17
4: 150
1168112463_1168112469 15 Left 1168112463 19:54201229-54201251 CCCGCGGAGACCCTTCGAGAAAT 0: 2
1: 0
2: 2
3: 4
4: 36
Right 1168112469 19:54201267-54201289 AGCTGAAGCTGATCGGTGAGTGG 0: 1
1: 0
2: 2
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168112463 Original CRISPR ATTTCTCGAAGGGTCTCCGC GGG (reversed) Exonic
903440639 1:23385515-23385537 AATTCTCCAAGGGACTCCTCCGG + Intronic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
915518089 1:156425052-156425074 ATTAGTAGAAGGGTCTCCTCTGG - Intronic
921804907 1:219443062-219443084 ATTTCTCCAAGAGTTTCTGCTGG + Intergenic
1074121455 10:110497095-110497117 AGTTCACCAAGGGTCTCCCCGGG + Intergenic
1079428854 11:20369368-20369390 ATTTCTTGAAGTTTCTCTGCTGG - Intronic
1130935255 15:88464732-88464754 GTTCCTCGAAGGGTCTCCCCAGG + Exonic
1130988342 15:88859270-88859292 ATTTCTAGATGCGTCTCTGCAGG - Exonic
1156096877 18:33544205-33544227 ATTTCTGGAAGGGTTCCCTCGGG + Intergenic
1167479353 19:49720015-49720037 ATTTCTCGAAGGGTCTCCGCGGG + Intergenic
1168112463 19:54201229-54201251 ATTTCTCGAAGGGTCTCCGCGGG - Exonic
925404824 2:3599265-3599287 ATTTCTGTAAGGGGCTCTGCAGG + Intronic
935222406 2:101027022-101027044 ATTTCAAAAAGGGTCACCGCAGG + Intronic
935267977 2:101410814-101410836 ATAGCTCGAAGGGACTCCCCAGG + Intronic
942156256 2:173131724-173131746 AGTTCTCTAAGGGTCTGCTCAGG + Intronic
1178840191 21:36132494-36132516 GTTTCTCGAAGGGTCTCTGCAGG - Intergenic
1183908914 22:41064096-41064118 ATTTCTCAAAGGATCTCCGCGGG - Intergenic
951146578 3:19234437-19234459 ATTTCTCGCAGGGCCTTAGCTGG - Intronic
956972270 3:74539924-74539946 AGTTCTGGAAGGCTCTCTGCTGG - Intergenic
957841691 3:85679214-85679236 CTTTCTCGAAGAGTCTTCCCTGG - Intronic
988834047 5:35014140-35014162 ATTTCTTGAAGGGTTTCCAATGG - Intronic
989606098 5:43245904-43245926 GTTTCTCGAAGGGCGTCAGCTGG - Exonic
991634479 5:68690499-68690521 AGTTCTAGAAGGGTGTCCCCAGG + Intergenic
1001596270 5:172900909-172900931 GTTGCCCGAAGGGCCTCCGCAGG + Intronic
1003788106 6:9510677-9510699 ATTTTTTGAATGGTCTCTGCTGG + Intergenic
1011661703 6:89600360-89600382 ATTTCACGAAGGGCCTTCACTGG - Intronic
1013674058 6:112437277-112437299 ATTTCTTTAAGGGTCTCTGAGGG - Intergenic
1015767015 6:136729491-136729513 ATTGCTCAAAGGGTCTCCTCTGG - Intronic
1016363640 6:143293160-143293182 CTTTCTCCTAGGGTCTCTGCAGG - Intronic
1016414756 6:143820750-143820772 ATTCCACAAAGGGTCTCTGCTGG - Intronic
1033830739 7:145249294-145249316 ATTTCAGGAAGTGTTTCCGCTGG - Intergenic
1036206351 8:6808163-6808185 ATTTCACGAAGGGGCTCTTCTGG + Intergenic
1039473521 8:37827630-37827652 TCTTCTCCATGGGTCTCCGCAGG - Intronic
1046244582 8:111542434-111542456 ATTCCTAGAAGGGACTCCCCAGG - Intergenic
1047521477 8:125598543-125598565 ATTTCTCGGAGGGTCCCAGCAGG + Intergenic
1047537087 8:125729783-125729805 GTTTCTCCAAGGCTCTCAGCTGG - Intergenic
1047963718 8:130029826-130029848 ATTTTTCCAAGGGTCACAGCAGG + Intergenic
1057036610 9:91816267-91816289 ATCTCTTGAAGGGTCTCCTGTGG - Intronic
1059619351 9:115986506-115986528 ATTCCTCCAAGGGTGTCAGCAGG - Intergenic
1060218410 9:121752033-121752055 ATGTTTAGAAGGGTCTCGGCTGG + Intronic
1192511825 X:71725008-71725030 ATTTCTCTAAGTGTCCCTGCAGG + Intergenic
1192514872 X:71756497-71756519 ATTTCTCTAAGTGTCCCTGCAGG - Intergenic
1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG + Intergenic
1201076204 Y:10191343-10191365 ATTTTTTGAAGGGTCTCCGGTGG + Intergenic