ID: 1168113909

View in Genome Browser
Species Human (GRCh38)
Location 19:54210129-54210151
Sequence GAGTCGTGGGTGAAGCTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168113902_1168113909 1 Left 1168113902 19:54210105-54210127 CCAGGCATGCTGCCAGGAGGAGG 0: 1
1: 0
2: 4
3: 76
4: 564
Right 1168113909 19:54210129-54210151 GAGTCGTGGGTGAAGCTGATAGG 0: 1
1: 0
2: 0
3: 11
4: 101
1168113899_1168113909 7 Left 1168113899 19:54210099-54210121 CCACATCCAGGCATGCTGCCAGG 0: 1
1: 0
2: 2
3: 24
4: 318
Right 1168113909 19:54210129-54210151 GAGTCGTGGGTGAAGCTGATAGG 0: 1
1: 0
2: 0
3: 11
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168113909 Original CRISPR GAGTCGTGGGTGAAGCTGAT AGG Intronic
900549592 1:3247582-3247604 GAGTCCAGGGCGAAGCTGAAGGG - Intronic
900780200 1:4612976-4612998 GAGTCGTGGATGAGGCAAATTGG - Intergenic
903603647 1:24559459-24559481 GGGGTGTGGGTGAAGCTGAGGGG + Intronic
904891209 1:33780989-33781011 GAGTGGTGAGTGATGCTGGTCGG + Intronic
907291940 1:53420606-53420628 GAGTGGTGGGTGAAGGTGGGAGG - Intergenic
908440540 1:64149562-64149584 GAGATGTGGGTGGAGCTGCTGGG - Intronic
910292278 1:85611235-85611257 GCGACGTGGGTGAATCTCATAGG - Intergenic
912945477 1:114080811-114080833 GAGTCAAGGGTTAAACTGATGGG + Intergenic
916259073 1:162822584-162822606 GAGCCGTGGGTGGAGCCGCTGGG + Intergenic
916853360 1:168726241-168726263 GAGTCAAGGGAAAAGCTGATAGG - Intronic
917790589 1:178496470-178496492 GAGCCGTGGGTGAGCCTGAGGGG - Intergenic
919163050 1:193856477-193856499 GAGCAGTGGCTGAATCTGATGGG + Intergenic
923451719 1:234124338-234124360 GAGCTGTGGGTGAAGCTTAGTGG - Intronic
1063220298 10:3961230-3961252 GAGCCTTGGGTGAATCTGAATGG - Intergenic
1063375437 10:5551697-5551719 GAGTCCTGGGTGACCCTGACAGG - Intergenic
1069290586 10:66774221-66774243 GAGTCCTAGGTGAAGCAGATGGG + Intronic
1070997448 10:80797984-80798006 GAGCCGGGGGAGAAGCTGGTGGG + Intergenic
1087762355 11:102114272-102114294 GAGCTGTGGGTGTAGCTGCTGGG - Exonic
1090420000 11:126568163-126568185 GACTCCTGGGTGAGGCTCATTGG - Intronic
1094754675 12:33454316-33454338 AGGTGGTGGGTGAAGCTGAGGGG - Intergenic
1103888372 12:124220167-124220189 GCCTCATAGGTGAAGCTGATTGG - Intronic
1105641278 13:22267647-22267669 GAGTGGTGTGTGTAGCTTATGGG + Intergenic
1111608934 13:90578118-90578140 GAATCTTGTGTGAGGCTGATTGG + Intergenic
1111765608 13:92524034-92524056 GAGTGGTGGTTGATGCTAATTGG + Intronic
1115945132 14:38651415-38651437 GAGAAGTAGGTGAATCTGATTGG - Intergenic
1115966865 14:38899878-38899900 TAGCTGTGAGTGAAGCTGATGGG - Intergenic
1116119578 14:40705521-40705543 GAGACCTGGGGGAAGGTGATTGG - Intergenic
1119730630 14:76948765-76948787 GAGTAGTGGGTGGGGCTGAGGGG - Intergenic
1122136291 14:99634939-99634961 GCGGCGTGGGTGAAGGAGATGGG - Intergenic
1123487170 15:20751745-20751767 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1123543660 15:21320800-21320822 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1131696202 15:94880646-94880668 GAGTGCAGGGTGAAGATGATTGG + Intergenic
1132333842 15:101030557-101030579 GGGGCGTGGGGGAAGGTGATCGG - Intronic
1202951977 15_KI270727v1_random:47926-47948 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1134517125 16:14896233-14896255 GAGTCCTGAGTGAAGCTGGCTGG + Intronic
1134704793 16:16294887-16294909 GAGTCCTGAGTGAAGCTGGCTGG + Intergenic
1134962749 16:18417227-18417249 GAGTCCTGAGTGAAGCTGGCTGG - Intergenic
1134967044 16:18499826-18499848 GAGTCCTGAGTGAAGCTGGCTGG - Intronic
1143559862 17:7687177-7687199 GAGACCTGGGTGTAGATGATGGG - Exonic
1159557582 18:69961615-69961637 GAGTCGTGGGTGAAGTTTGCTGG - Intronic
1160063510 18:75553010-75553032 CAGTCTTGGGTGATGCTGAATGG + Intergenic
1162243510 19:9378879-9378901 GAATGGTGGGTGAGGCTGACAGG - Intronic
1162935296 19:13978901-13978923 GAGCAGTGGGTGGAGCTGGTGGG - Intronic
1166720824 19:44994811-44994833 GAGTTGTGGGGGTAGCTGATGGG - Intergenic
1168113909 19:54210129-54210151 GAGTCGTGGGTGAAGCTGATAGG + Intronic
926573273 2:14553174-14553196 GAGAGGTGGGAGAAGCAGATTGG - Intergenic
926689271 2:15721848-15721870 GAGCCGTGTGTGAAGGTGCTAGG - Intronic
930580803 2:53209525-53209547 GAGTCTTGGGTGAAGAGAATGGG + Intergenic
933726778 2:85431485-85431507 GCACCGTGGGTGAAGCTGAAGGG - Intronic
941079617 2:161045529-161045551 GAGTGGTGGGTGAAGATGGAAGG - Intergenic
945683276 2:212938635-212938657 CAGTGGTGAGTGAAGCTGATGGG + Intergenic
946211394 2:218150126-218150148 GTGGCTTGGGTGAAGGTGATGGG - Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948556419 2:238814355-238814377 GAGGAGGGGCTGAAGCTGATGGG + Intergenic
948878449 2:240842683-240842705 GAGTCGGGGGAGCAGGTGATCGG + Intergenic
948878460 2:240842736-240842758 GAGTCGGGGGAGCAGGTGATCGG + Intergenic
948878469 2:240842790-240842812 GAGTCGGGGGAGCAGGTGATCGG + Intergenic
948878508 2:240843008-240843030 GAGTCGGGGGAGCAGGTGATTGG + Intergenic
948878529 2:240843116-240843138 GAGTCGGGGGAGCAGGTGATTGG + Intergenic
948878546 2:240843196-240843218 GAGTCGGGGGAGCAGGTGATCGG + Intergenic
948878555 2:240843250-240843272 GAGTCGGGGGAGCAGGTGATCGG + Intergenic
948878575 2:240843359-240843381 GAGTCGGGGGAGCAGGTGATTGG + Intergenic
948878598 2:240843467-240843489 GAGTCGGGGGAGCAGGTGATGGG + Intergenic
1169190793 20:3658152-3658174 GAGTCCTGACTGAAGCTGAGAGG + Intergenic
1169904358 20:10585918-10585940 GATTTCTGGGTGAAGCTGTTTGG - Intronic
1172775177 20:37403103-37403125 GTGGGGTGGGGGAAGCTGATGGG - Intronic
1173058069 20:39635670-39635692 GGGTGGTGGCTGAAGCTGGTTGG + Intergenic
1173422037 20:42909990-42910012 GAGGCGTGGAAGAAGCTGCTAGG - Intronic
1174389113 20:50206681-50206703 AAGTCCTGGGTGATGCTGAAGGG + Intergenic
1177258721 21:18700553-18700575 GGGTCCTGGTTGAAGGTGATTGG + Intergenic
1179910139 21:44443091-44443113 GTGTCCTTGGTGACGCTGATGGG - Intergenic
1183965103 22:41436807-41436829 GAGGCGGTGGTGAAGGTGATGGG + Exonic
952150057 3:30579446-30579468 GACTCATGGCTAAAGCTGATTGG + Intergenic
953362485 3:42310087-42310109 GAGTCGTAGGTGAATTTGAAAGG - Intergenic
965562741 3:170077428-170077450 GAGTGGTGGGAGAAACTGTTGGG + Intronic
968697134 4:2036741-2036763 GAGTCGTGGGTGGGGCTGTTTGG + Intronic
969435710 4:7188148-7188170 GAGGTGAGGGTGAAGCTGAAGGG + Intergenic
974373979 4:61052739-61052761 GAATTGTGGTTGAAGTTGATGGG + Intergenic
979789553 4:124761581-124761603 GAGTGGTTGGAGAGGCTGATTGG + Intergenic
982866197 4:160515051-160515073 GAGGCGGGGGTGAAGCAGAATGG - Intergenic
994518613 5:100800723-100800745 GAATCGTGGGTGAAGCCGAGAGG - Intergenic
999562844 5:152824081-152824103 GAGAAGTGGGGGAAGGTGATAGG - Intergenic
1000302076 5:159965463-159965485 GTGTGGTGGGTGAAGCTGCTGGG - Intronic
1000916826 5:167092888-167092910 AATTCGAGGGTGAAGATGATAGG + Intergenic
1001350392 5:170957268-170957290 GAGCCTTGGGTGAAGTTCATGGG + Intronic
1004438491 6:15621924-15621946 GAGTCCTGTGTGAGGCTGAAAGG - Intronic
1005682161 6:28218140-28218162 GAGTCCATGGTGAAGGTGATGGG + Intergenic
1005854149 6:29847863-29847885 GAGTCCTGGATGAACCTGACAGG + Intergenic
1007161662 6:39796036-39796058 GAGTAATGGGGGAATCTGATGGG + Intronic
1008091678 6:47300214-47300236 GAGCAGTGGGTGAAACTGAGAGG - Intronic
1009893241 6:69714822-69714844 AAGTCGTGGGAGAGGATGATTGG - Intronic
1016728993 6:147407336-147407358 GAGCTGTGGGTGTAGCTGCTGGG - Intergenic
1017077630 6:150633443-150633465 GAGTCGCAGGTGAAGCTGGTGGG + Intronic
1021787017 7:24162665-24162687 GGGACGTGGCTGAAGGTGATTGG + Intergenic
1025607611 7:63050718-63050740 GAGTGGTGGGAGAAGATGAGGGG - Intergenic
1033884308 7:145926877-145926899 GTGTACTGGGAGAAGCTGATGGG - Intergenic
1034295776 7:149971187-149971209 GAGGCGAGGGTGAAGATAATGGG - Intergenic
1034810275 7:154125717-154125739 GAGGCGAGGGTGAAGATAATGGG + Intronic
1038804557 8:30778416-30778438 GAGTCCTGGGAGAAGCAGATGGG - Intronic
1042206730 8:66337160-66337182 GTTTCCTGGGTGAAGATGATGGG - Intergenic
1044550472 8:93506424-93506446 GAGTCATGCTTGAAGGTGATGGG - Intergenic
1048860877 8:138723906-138723928 GAGGCGGAGGTGAAGCAGATTGG - Intronic
1051241554 9:15062233-15062255 GGGACGTGGATGAAGCTGAAAGG - Intergenic
1052833539 9:33234104-33234126 GAGTCATGGGTTCTGCTGATGGG - Intronic
1057596204 9:96417956-96417978 GAGTCGTGGCAGAAGATGACGGG + Exonic
1059084354 9:111284065-111284087 GAGTTGTTGGTCAAGATGATAGG - Intergenic
1060528351 9:124333080-124333102 GAGTCGTCGGGGAAGCTGGCAGG - Intronic
1062672825 9:137721543-137721565 GAGGCGTGGGAGAAGGTGAGAGG - Intronic
1187087693 X:16058842-16058864 GAGATGTGGGGGAAGGTGATTGG - Intergenic
1191077680 X:56472739-56472761 GAGTCCTGGTGGAAGGTGATTGG + Intergenic
1192764999 X:74131000-74131022 TAGTGTTGGATGAAGCTGATAGG + Intergenic
1200046615 X:153406350-153406372 GGGTAGTGGGTGTATCTGATTGG + Intergenic
1201339289 Y:12915635-12915657 TAGTGTTGGATGAAGCTGATAGG + Exonic