ID: 1168115317

View in Genome Browser
Species Human (GRCh38)
Location 19:54219021-54219043
Sequence CAGTTTAGAAAACCGGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168115317_1168115328 30 Left 1168115317 19:54219021-54219043 CCTGGAACCGGTTTTCTAAACTG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1168115328 19:54219074-54219096 TGGTGCCCTGAGCCCACCCTCGG 0: 1
1: 2
2: 3
3: 32
4: 300
1168115317_1168115324 6 Left 1168115317 19:54219021-54219043 CCTGGAACCGGTTTTCTAAACTG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1168115324 19:54219050-54219072 CTGTGTGTTTGGGTTCCCTCTGG 0: 1
1: 0
2: 2
3: 23
4: 324
1168115317_1168115325 10 Left 1168115317 19:54219021-54219043 CCTGGAACCGGTTTTCTAAACTG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1168115325 19:54219054-54219076 GTGTTTGGGTTCCCTCTGGCTGG 0: 1
1: 1
2: 0
3: 12
4: 137
1168115317_1168115319 -5 Left 1168115317 19:54219021-54219043 CCTGGAACCGGTTTTCTAAACTG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1168115319 19:54219039-54219061 AACTGACACCCCTGTGTGTTTGG 0: 1
1: 0
2: 0
3: 10
4: 114
1168115317_1168115320 -4 Left 1168115317 19:54219021-54219043 CCTGGAACCGGTTTTCTAAACTG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1168115320 19:54219040-54219062 ACTGACACCCCTGTGTGTTTGGG 0: 1
1: 0
2: 1
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168115317 Original CRISPR CAGTTTAGAAAACCGGTTCC AGG (reversed) Intronic
900211247 1:1456868-1456890 CACTTTAGAAGACCTGTCCCTGG + Intronic
900550057 1:3250139-3250161 CAGTTGTGAAAACGGGATCCTGG - Intronic
902317967 1:15637837-15637859 CAGATTAGAAAACCCAGTCCTGG + Intronic
903999184 1:27328806-27328828 CAGTTTAAAAAAGCAGTTACAGG - Intronic
905300171 1:36981531-36981553 CAGTTGAGAAAACTGAGTCCTGG + Intronic
907367659 1:53975982-53976004 CAGTTGAGAAAACCGTTTATTGG - Intergenic
911079413 1:93913563-93913585 CTTTTCAGAAAACCGGCTCCTGG + Intergenic
911705255 1:101004150-101004172 CAGTTTATAAATCAGGGTCCTGG - Intronic
913695910 1:121325404-121325426 CAGCTTAGAAAAGAGCTTCCTGG - Intronic
914141653 1:144954655-144954677 CAGCTTAGAAAAGAGCTTCCTGG + Intronic
919081910 1:192877307-192877329 CATTTCTGAAAACCTGTTCCTGG - Intergenic
920483236 1:206343772-206343794 CAGCTTAGAAAAGAGCTTCCTGG - Intronic
923842473 1:237688199-237688221 CAGTTTATAAAATCGGATGCAGG - Intronic
1065649250 10:27870292-27870314 CACTTTAGGAAACAGTTTCCAGG - Intronic
1076028120 10:127134055-127134077 CTGTTTAGAAAACCTGTCACTGG - Intronic
1078376487 11:10798242-10798264 CAGTTTAAAAAGCAGGTTCCAGG - Intronic
1080332875 11:31160804-31160826 CTGTTTAGAACACCATTTCCTGG + Intronic
1085158655 11:74320679-74320701 CAGTTGAGAAAACCAGTTTATGG + Intergenic
1087751176 11:102009068-102009090 CAGTATAGAAAATCTGTTACAGG - Intergenic
1089707214 11:120287475-120287497 ATGTCTAGAAAACCTGTTCCAGG - Intronic
1092621402 12:10274555-10274577 CAGTTTAGACAAACGCCTCCAGG - Intergenic
1092934463 12:13347621-13347643 CAGTTTAGAAAAGCTCTCCCTGG - Intergenic
1098254256 12:68600312-68600334 CAGATTAGAAAACAGGTTGCTGG - Intergenic
1098927776 12:76371114-76371136 CAGGTTAGAAAACTGTTGCCAGG + Intronic
1099029036 12:77502073-77502095 CAGTTTAGAAAACCAAAACCTGG + Intergenic
1108839550 13:54594911-54594933 CAGTTTAGAAAACATATTTCAGG + Intergenic
1113937624 13:114002773-114002795 CCGGTTAGAAAACCGACTCCTGG - Intronic
1114288308 14:21266793-21266815 CAATTTAGAAAACCGGGGCCGGG + Intronic
1114721648 14:24888994-24889016 CAGATTAGAAAACCCTTCCCTGG + Intronic
1121066924 14:90976273-90976295 CTGGTAAGAAAACAGGTTCCTGG - Intronic
1121896462 14:97652654-97652676 GAGTTTAGGAAGCTGGTTCCTGG - Intergenic
1123763524 15:23451672-23451694 CAGTTTTGAAATCCGGTCACTGG + Intergenic
1125929066 15:43586766-43586788 AAGTTCAGAAAACCTGTTCAGGG + Intronic
1125942233 15:43686598-43686620 AAGTTCAGAAAACCTGTTCAGGG + Intergenic
1126235506 15:46378944-46378966 CATTTCAGAAAACCAGCTCCTGG + Intergenic
1128457590 15:67840863-67840885 CAGTTTAGCAAACAGGCTCTGGG + Intergenic
1129062648 15:72872625-72872647 CATTTTAGAAAATCTTTTCCTGG + Intergenic
1130330303 15:82917289-82917311 CAGATTAGAAAACCGTTTGGCGG - Intronic
1131718163 15:95136328-95136350 CAGTATAAAGAACCTGTTCCGGG + Intergenic
1132125727 15:99222695-99222717 CAGTTTTAAAACACGGTTCCAGG + Intronic
1135139391 16:19908575-19908597 CAGATAAGAAAACCGAGTCCAGG - Intergenic
1135930814 16:26734954-26734976 CAGTTTAGAGAACGGCTTCTTGG - Intergenic
1138866599 16:60828949-60828971 CACTTTAAAAAACCAGCTCCTGG + Intergenic
1142868260 17:2804402-2804424 GAGTTTAGGAAACCCGTTCAAGG + Intronic
1150143770 17:62751277-62751299 CAGGTGAGGAAACAGGTTCCGGG - Intronic
1151075020 17:71261498-71261520 CAGTTTAAAAAACAGTTTCAAGG - Intergenic
1153742986 18:8148585-8148607 CTTTTCAGAAAACCAGTTCCTGG + Intronic
1156070538 18:33201866-33201888 CAGTTTGGTAAACCGGTTGGGGG - Intronic
1156699916 18:39813830-39813852 CAGTTTAGAAAACATGTTTCAGG - Intergenic
1164358602 19:27472218-27472240 CAGTTTGGAAAATCAGTTCTTGG - Intergenic
1168115317 19:54219021-54219043 CAGTTTAGAAAACCGGTTCCAGG - Intronic
926838757 2:17054318-17054340 AAGTTTAGAAAAGCAGTTGCTGG + Intergenic
928197620 2:29226812-29226834 AAGTTTACAAAACCGAATCCAGG + Intronic
928957812 2:36889268-36889290 CAGTTTAGAAAACTGTTTCCTGG + Intronic
930801283 2:55445295-55445317 CCTTTCAAAAAACCGGTTCCTGG - Intergenic
933371513 2:81420946-81420968 CAATTTAGAAAACTTTTTCCTGG + Intergenic
936378327 2:111961902-111961924 CAGCCTAGAAAAGCTGTTCCTGG - Intronic
936767612 2:115872564-115872586 CAGATTAGAAACCCTCTTCCAGG + Intergenic
938925524 2:136037696-136037718 CAGCTTGGAAAACCGTTTCATGG - Intergenic
940536971 2:154957578-154957600 CCTTTCAGAAAACCGGCTCCTGG + Intergenic
941709151 2:168693504-168693526 AAGTTTAGAAAATCGGGCCCTGG - Intronic
1177107445 21:16977814-16977836 CAGATAAGAAAACAGGTTCAGGG + Intergenic
1179347259 21:40570186-40570208 CAGTTTGGAAAGCTGGTTACTGG + Intronic
1182515845 22:30858576-30858598 CAGTTTATAAAACCCTTTCCTGG + Intronic
1184225142 22:43125403-43125425 CATTTTAGAAAACCAGAACCGGG + Intronic
951836823 3:26992680-26992702 CTTTTTAGAAAACCAGCTCCTGG - Intergenic
952708872 3:36408600-36408622 CAGTCTAGAAAACCTTTTCCAGG - Intronic
954314687 3:49794799-49794821 CAGTCTGGAAAACAGGATCCAGG - Intronic
954624208 3:52013664-52013686 CTGAGTAGAAAACCTGTTCCAGG - Intergenic
954764549 3:52902358-52902380 AAGTTTAGAAAACAGGTTAATGG - Intergenic
956200667 3:66702282-66702304 CTATTTAGAAAACCGTCTCCAGG - Intergenic
958536013 3:95404606-95404628 TAGTTTATAAAACTGGTTTCAGG - Intergenic
965097890 3:164257620-164257642 CTTTTCAGAAAACCAGTTCCTGG - Intergenic
965621634 3:170648076-170648098 CATTTCAAAAAACCAGTTCCTGG + Intronic
965725275 3:171709469-171709491 CAGTTTTGAAAACTGATTCCAGG + Intronic
966465879 3:180230946-180230968 CAGGTTAGAAAACCTGTACAGGG - Intergenic
967838367 3:193983219-193983241 CAGATGAGAAAATCGGTTCAAGG + Intergenic
973038192 4:45435005-45435027 CAGTAAAGAAAACAGGTTCAGGG - Intergenic
976100944 4:81562601-81562623 AAGTTCAGAAAACCTGTTACTGG + Intronic
976745865 4:88402489-88402511 CAGTTTAAAAACCCTGATCCAGG + Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
983085542 4:163440008-163440030 CTGTTTTGATAACTGGTTCCTGG + Intergenic
984797027 4:183671165-183671187 CTAATTAGAAAACCGCTTCCAGG - Intronic
986337090 5:6763348-6763370 CAGTTCTGAAGACCCGTTCCGGG - Intergenic
989919224 5:49777259-49777281 CAGTTTTGAAAACCTCTTTCTGG + Intergenic
992159534 5:73987298-73987320 CAGTTTAGACAACCTGCTCAAGG - Intergenic
992513866 5:77471482-77471504 CTTTTCAAAAAACCGGTTCCGGG - Intronic
993438026 5:87921914-87921936 CATTTTAAAAAAACAGTTCCTGG + Intergenic
994345661 5:98682990-98683012 CTTTTTAGAAAACCAGCTCCTGG - Intergenic
997277327 5:132606182-132606204 CTTTTTAAAAAACCAGTTCCTGG - Intronic
997436976 5:133882585-133882607 AAGTTTAGAAAACCTGTCCAGGG - Intergenic
999959014 5:156734462-156734484 CAATTTAGAAAACATGTTCCAGG - Intronic
1000132921 5:158317425-158317447 CAGTTGAGAAAATTGGGTCCTGG - Intergenic
1003983390 6:11411053-11411075 CAGAGTAGAAAATAGGTTCCAGG - Intergenic
1009705621 6:67247116-67247138 CAGTTTGGAAAACCTGTTTAAGG + Intergenic
1011298653 6:85850822-85850844 CATTTTAAAAAACCAGCTCCTGG + Intergenic
1013718678 6:112995467-112995489 AAGTTTTGAAAACCTGTTCCAGG + Intergenic
1015049957 6:128828457-128828479 CAGTTTACTAAACCAGTTGCTGG - Intergenic
1015766302 6:136720748-136720770 CATTTTATAAAACCACTTCCAGG - Intronic
1017908576 6:158773489-158773511 CAGTTTAAAAACCCTGCTCCAGG - Intronic
1021390905 7:20091648-20091670 GATTTTAAAAAACCGGCTCCTGG - Intergenic
1028472140 7:91217314-91217336 CCTTTTAAAAAACCAGTTCCTGG - Intergenic
1031522582 7:122784652-122784674 CAGATGAGAAAACCAGTGCCAGG + Intronic
1040093694 8:43422063-43422085 AAGTCTAGAAAGCCGGTGCCTGG + Intergenic
1042329306 8:67561202-67561224 TAGTTAAAAAAACTGGTTCCAGG + Intronic
1045040654 8:98220733-98220755 CATTTTACCAAACCGGTTCTTGG + Intronic
1052499700 9:29273397-29273419 CATTTCAGAAAACCAGCTCCTGG - Intergenic
1055550554 9:77428611-77428633 AAGTTTAGAACCCAGGTTCCAGG + Intronic
1189540688 X:41984849-41984871 CAGGCTATAAAACCGGTTTCAGG - Intergenic
1194314987 X:92366426-92366448 CTTTTCATAAAACCGGTTCCTGG + Intronic
1198039060 X:132831333-132831355 CAGATTAGAAGACCGATGCCAGG - Intronic
1200323296 X:155212405-155212427 CAATTTAGAAAACCTGATCTTGG - Intronic
1200623037 Y:5477954-5477976 CTTTTCATAAAACCGGTTCCTGG + Intronic