ID: 1168118368

View in Genome Browser
Species Human (GRCh38)
Location 19:54238909-54238931
Sequence CTGAGGCTCCACCACGCTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168118364_1168118368 2 Left 1168118364 19:54238884-54238906 CCTTCTGGGATCATCAGATCTGT 0: 1
1: 2
2: 1
3: 24
4: 160
Right 1168118368 19:54238909-54238931 CTGAGGCTCCACCACGCTGAAGG 0: 2
1: 0
2: 1
3: 13
4: 136
1168118362_1168118368 11 Left 1168118362 19:54238875-54238897 CCTCCAGAGCCTTCTGGGATCAT 0: 1
1: 1
2: 0
3: 17
4: 241
Right 1168118368 19:54238909-54238931 CTGAGGCTCCACCACGCTGAAGG 0: 2
1: 0
2: 1
3: 13
4: 136
1168118359_1168118368 21 Left 1168118359 19:54238865-54238887 CCTAGATTGTCCTCCAGAGCCTT 0: 1
1: 1
2: 0
3: 29
4: 381
Right 1168118368 19:54238909-54238931 CTGAGGCTCCACCACGCTGAAGG 0: 2
1: 0
2: 1
3: 13
4: 136
1168118363_1168118368 8 Left 1168118363 19:54238878-54238900 CCAGAGCCTTCTGGGATCATCAG 0: 1
1: 1
2: 2
3: 19
4: 201
Right 1168118368 19:54238909-54238931 CTGAGGCTCCACCACGCTGAAGG 0: 2
1: 0
2: 1
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168118368 Original CRISPR CTGAGGCTCCACCACGCTGA AGG Exonic