ID: 1168121558

View in Genome Browser
Species Human (GRCh38)
Location 19:54254886-54254908
Sequence CTTTAGACACAGCGGGGGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168121552_1168121558 5 Left 1168121552 19:54254858-54254880 CCTGGTGTCTATAAGACTGGTAC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1168121558 19:54254886-54254908 CTTTAGACACAGCGGGGGATGGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168121558 Original CRISPR CTTTAGACACAGCGGGGGAT GGG Exonic
900702290 1:4055806-4055828 GTTTACACACAGTGGGGGACAGG - Intergenic
901761085 1:11472046-11472068 CTGTAAACACACCGTGGGATTGG - Intergenic
904784237 1:32973409-32973431 CAGCAGACACAGCGGGGGATGGG + Intergenic
907238061 1:53064865-53064887 CTTTAGAGACAGAAGGGCATGGG - Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
908107091 1:60856228-60856250 CTTCAGAAACAACAGGGGATGGG - Intergenic
1072310508 10:94149828-94149850 CTTCAGAGACAGCAGGGGCTGGG + Intronic
1072508472 10:96093751-96093773 ATATAGCCACAGCGGGGGTTAGG + Intergenic
1074892356 10:117746255-117746277 CAAGAGACACAGCGGGGCATGGG - Intergenic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1082013988 11:47470725-47470747 CTGTAGCCACAGCCAGGGATGGG - Exonic
1084261876 11:67984225-67984247 CCTAAGAGCCAGCGGGGGATAGG + Intergenic
1090080886 11:123611843-123611865 CCTTAGTCACAGGGCGGGATGGG + Intronic
1090227032 11:125077846-125077868 GTTTGGACACAGCAGAGGATGGG - Intronic
1092026397 12:5244505-5244527 CTTTAGAAAAAGCGGGGGTTGGG + Intergenic
1102953591 12:117045761-117045783 CTTTAGACACACAGGGGCAAAGG + Intronic
1108424214 13:50282193-50282215 CTTTAGACAAAGAGGGGCCTTGG + Intronic
1118375005 14:65169227-65169249 CTTTAGCCACAGAGGAGGCTGGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1133418199 16:5623131-5623153 CTTTAGACTAAGCCAGGGATTGG - Intergenic
1138781663 16:59795941-59795963 CTTTAGATACAGGTGGGCATTGG + Intergenic
1139823909 16:69742174-69742196 CTGCAGACCCAGCGGGGCATGGG + Exonic
1145838569 17:27974348-27974370 ATATAGCCACATCGGGGGATAGG + Intergenic
1148737628 17:49873721-49873743 CATGAGACAAGGCGGGGGATGGG + Intergenic
1153637727 18:7127628-7127650 TTTTAGACACCGTGGGGGAGTGG - Intergenic
1156267970 18:35505296-35505318 CTTTCGACAAAGTGAGGGATGGG - Intergenic
1160720216 19:593977-593999 CTTTAGAATCAGCGGCGGCTGGG - Intronic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1166053852 19:40277097-40277119 CTTCACACACAGCTGGGGACAGG + Intronic
1166415035 19:42589166-42589188 CAGTAGAAACAGCGGGGGTTTGG - Intronic
1167636847 19:50660151-50660173 CTTTACCCACAGCAGGGGAGGGG + Intronic
1168121558 19:54254886-54254908 CTTTAGACACAGCGGGGGATGGG + Exonic
1168185735 19:54698324-54698346 TCTCAGACACAGCAGGGGATGGG - Intronic
926882050 2:17556580-17556602 CTTAGGACAGAGCGGGGGATAGG + Intronic
927363832 2:22270519-22270541 CATTAGACACAGCAGGAGAGAGG + Intergenic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
940256496 2:151736528-151736550 CTTTCCACACATCGGGGGGTAGG - Intergenic
945010106 2:205451960-205451982 ATTTAGACAGAGCGGTGGAAGGG - Intronic
947340078 2:229129152-229129174 CTTTGGAGACAGCGGGGCTTGGG - Intronic
948295309 2:236856207-236856229 CTTTAGACACTGCCTGGGAAGGG + Intergenic
948422874 2:237871263-237871285 CTTTAGACAGAGCAGGGGCAGGG + Intronic
1169385484 20:5145677-5145699 CCTTAGAAACAGCAGGGGACAGG - Intronic
1169796646 20:9469778-9469800 CTTTAGACACAGCTGGTGAAGGG + Intronic
1173585909 20:44182926-44182948 TTTTAGACACATTGGGAGATGGG + Intronic
1174087966 20:48023127-48023149 ATTTAGACAAAGCAGGAGATAGG + Intergenic
1175221993 20:57422508-57422530 CTAAAGGCACAGTGGGGGATGGG + Intergenic
1183941982 22:41301246-41301268 CTTTTGACACAGATGGGGAAGGG + Intergenic
1184233630 22:43171559-43171581 ATGTGGACACAGAGGGGGATGGG - Intronic
949561032 3:5202955-5202977 CTTTAGATTCACCTGGGGATGGG - Exonic
955552462 3:60099082-60099104 TTTTAGGCACAGTGGGAGATGGG - Intronic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968843015 4:3021898-3021920 CCGTGGACACAGCGGTGGATGGG - Intronic
968963456 4:3757538-3757560 CTTTGGCCACAGCTGGGGACAGG + Intergenic
969520809 4:7676864-7676886 CTTCAGACACAGAGAGGGAGAGG - Intronic
974256084 4:59457494-59457516 CTTTAGATACAGCAGTGCATTGG - Intergenic
979817943 4:125133509-125133531 ATTTAAACACATCAGGGGATGGG + Intergenic
992570340 5:78048917-78048939 CTTTAGAGAAAGTGGGGGAAGGG - Intronic
996135055 5:119831539-119831561 CTTTGGACACAGTGGAGCATTGG + Intergenic
997410234 5:133685443-133685465 CTGTAGACACAGCGTGTGCTAGG - Intergenic
997716170 5:136044563-136044585 GTTTAGACACAGAGGGAGATGGG - Intronic
1007004108 6:38343855-38343877 TTTTAGACACAGCAGGTGTTAGG + Intronic
1012401065 6:98843358-98843380 CTTTAGGCCCAGCAGGGGAGTGG - Intergenic
1017960529 6:159217130-159217152 CTTCAGACAAGGAGGGGGATGGG + Intronic
1020202575 7:6091755-6091777 TTTTGGAGACAGTGGGGGATGGG + Intergenic
1020832981 7:13114130-13114152 CTTTATTCAAAGCAGGGGATAGG + Intergenic
1025265376 7:57452060-57452082 CTTAAGACACAGCTGAGGAAGGG - Intronic
1036726873 8:11228536-11228558 CTTTAGTCATAGCGGGGGTCCGG - Intergenic
1037491001 8:19397125-19397147 CTGTAGGCACAGGGGGGTATTGG - Intergenic
1037793909 8:21975218-21975240 CTTTTAACTCAGCGGGGGACAGG - Intronic
1039970317 8:42316402-42316424 CTTAGGACAGAGCAGGGGATGGG + Intronic
1045691995 8:104768993-104769015 CTTTTGATACAGCTGGAGATAGG - Intronic
1048166282 8:132064296-132064318 CGTTAGATACAGCTGGGTATTGG - Intronic
1186504315 X:10078504-10078526 ATATAGACACAGCGGGGGTACGG - Intronic
1187224126 X:17359584-17359606 CTTTAGAGACTGAGGGGCATGGG - Intergenic
1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG + Intronic
1196354441 X:114773882-114773904 GTTTGGACACAGGGTGGGATGGG - Intronic
1201189620 Y:11435896-11435918 CTGTGGACACCACGGGGGATGGG + Intergenic