ID: 1168131358

View in Genome Browser
Species Human (GRCh38)
Location 19:54321810-54321832
Sequence ACTCCACTGTGGGGAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168131358_1168131366 -7 Left 1168131358 19:54321810-54321832 CCTGGGCCTCCCCACAGTGGAGT No data
Right 1168131366 19:54321826-54321848 GTGGAGTCCTGGGCAGCTGTGGG No data
1168131358_1168131368 18 Left 1168131358 19:54321810-54321832 CCTGGGCCTCCCCACAGTGGAGT No data
Right 1168131368 19:54321851-54321873 AGATGAATGAGTTATCTTGAAGG No data
1168131358_1168131365 -8 Left 1168131358 19:54321810-54321832 CCTGGGCCTCCCCACAGTGGAGT No data
Right 1168131365 19:54321825-54321847 AGTGGAGTCCTGGGCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168131358 Original CRISPR ACTCCACTGTGGGGAGGCCC AGG (reversed) Intergenic