ID: 1168131360

View in Genome Browser
Species Human (GRCh38)
Location 19:54321816-54321838
Sequence CCCAGGACTCCACTGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168131360_1168131368 12 Left 1168131360 19:54321816-54321838 CCTCCCCACAGTGGAGTCCTGGG No data
Right 1168131368 19:54321851-54321873 AGATGAATGAGTTATCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168131360 Original CRISPR CCCAGGACTCCACTGTGGGG AGG (reversed) Intergenic