ID: 1168131363

View in Genome Browser
Species Human (GRCh38)
Location 19:54321820-54321842
Sequence GCTGCCCAGGACTCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168131363_1168131368 8 Left 1168131363 19:54321820-54321842 CCCACAGTGGAGTCCTGGGCAGC No data
Right 1168131368 19:54321851-54321873 AGATGAATGAGTTATCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168131363 Original CRISPR GCTGCCCAGGACTCCACTGT GGG (reversed) Intergenic
No off target data available for this crispr