ID: 1168131364

View in Genome Browser
Species Human (GRCh38)
Location 19:54321821-54321843
Sequence AGCTGCCCAGGACTCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168131364_1168131368 7 Left 1168131364 19:54321821-54321843 CCACAGTGGAGTCCTGGGCAGCT No data
Right 1168131368 19:54321851-54321873 AGATGAATGAGTTATCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168131364 Original CRISPR AGCTGCCCAGGACTCCACTG TGG (reversed) Intergenic