ID: 1168131366

View in Genome Browser
Species Human (GRCh38)
Location 19:54321826-54321848
Sequence GTGGAGTCCTGGGCAGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168131353_1168131366 30 Left 1168131353 19:54321773-54321795 CCCACTTAATTTCAATCAAAGAA No data
Right 1168131366 19:54321826-54321848 GTGGAGTCCTGGGCAGCTGTGGG No data
1168131354_1168131366 29 Left 1168131354 19:54321774-54321796 CCACTTAATTTCAATCAAAGAAA No data
Right 1168131366 19:54321826-54321848 GTGGAGTCCTGGGCAGCTGTGGG No data
1168131358_1168131366 -7 Left 1168131358 19:54321810-54321832 CCTGGGCCTCCCCACAGTGGAGT No data
Right 1168131366 19:54321826-54321848 GTGGAGTCCTGGGCAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168131366 Original CRISPR GTGGAGTCCTGGGCAGCTGT GGG Intergenic