ID: 1168131368

View in Genome Browser
Species Human (GRCh38)
Location 19:54321851-54321873
Sequence AGATGAATGAGTTATCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168131362_1168131368 9 Left 1168131362 19:54321819-54321841 CCCCACAGTGGAGTCCTGGGCAG No data
Right 1168131368 19:54321851-54321873 AGATGAATGAGTTATCTTGAAGG No data
1168131363_1168131368 8 Left 1168131363 19:54321820-54321842 CCCACAGTGGAGTCCTGGGCAGC No data
Right 1168131368 19:54321851-54321873 AGATGAATGAGTTATCTTGAAGG No data
1168131364_1168131368 7 Left 1168131364 19:54321821-54321843 CCACAGTGGAGTCCTGGGCAGCT No data
Right 1168131368 19:54321851-54321873 AGATGAATGAGTTATCTTGAAGG No data
1168131358_1168131368 18 Left 1168131358 19:54321810-54321832 CCTGGGCCTCCCCACAGTGGAGT No data
Right 1168131368 19:54321851-54321873 AGATGAATGAGTTATCTTGAAGG No data
1168131367_1168131368 -5 Left 1168131367 19:54321833-54321855 CCTGGGCAGCTGTGGGTGAGATG No data
Right 1168131368 19:54321851-54321873 AGATGAATGAGTTATCTTGAAGG No data
1168131360_1168131368 12 Left 1168131360 19:54321816-54321838 CCTCCCCACAGTGGAGTCCTGGG No data
Right 1168131368 19:54321851-54321873 AGATGAATGAGTTATCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168131368 Original CRISPR AGATGAATGAGTTATCTTGA AGG Intergenic