ID: 1168133903

View in Genome Browser
Species Human (GRCh38)
Location 19:54337934-54337956
Sequence ACCTGACACCAGTAGCTGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168133899_1168133903 12 Left 1168133899 19:54337899-54337921 CCTGACTTTGTATAAGGAAAAGC 0: 1
1: 0
2: 2
3: 14
4: 152
Right 1168133903 19:54337934-54337956 ACCTGACACCAGTAGCTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 153
1168133896_1168133903 20 Left 1168133896 19:54337891-54337913 CCTGGTGCCCTGACTTTGTATAA 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1168133903 19:54337934-54337956 ACCTGACACCAGTAGCTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 153
1168133898_1168133903 13 Left 1168133898 19:54337898-54337920 CCCTGACTTTGTATAAGGAAAAG 0: 1
1: 0
2: 1
3: 20
4: 236
Right 1168133903 19:54337934-54337956 ACCTGACACCAGTAGCTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168133903 Original CRISPR ACCTGACACCAGTAGCTGCA GGG Exonic
900723296 1:4194731-4194753 TCCTGGCACCAGTTCCTGCAGGG + Intergenic
900934337 1:5755808-5755830 CCCTGACAGCAGGAGCTCCAGGG + Intergenic
900948359 1:5843915-5843937 TCCTGACACCAGGGGCTGCCCGG - Intergenic
902173170 1:14629510-14629532 ACCTCACCCGAGTTGCTGCATGG - Intronic
902231247 1:15029109-15029131 ACCTGCCGCTTGTAGCTGCAAGG + Intronic
904652279 1:32014357-32014379 ACCTGCCGTCAGCAGCTGCATGG - Exonic
924033776 1:239914395-239914417 TCCTGACTACAGTAGCAGCATGG - Exonic
1063448731 10:6136871-6136893 ACCTCACCCCCTTAGCTGCAGGG - Intergenic
1064157462 10:12915907-12915929 ACCTGGCACCAGGGTCTGCAGGG + Intronic
1066326868 10:34369072-34369094 GTCTGACACCAGAATCTGCAGGG - Intronic
1067374996 10:45719788-45719810 CCCTGACACAGCTAGCTGCAGGG + Intergenic
1067378733 10:45752733-45752755 CCCTGACACAGCTAGCTGCAGGG - Intronic
1067882808 10:50061429-50061451 CCCTGACACAGCTAGCTGCAGGG + Intergenic
1067886432 10:50093413-50093435 CCCTGACACAGCTAGCTGCAGGG - Intronic
1073103970 10:101021869-101021891 ACCTGACACCGTTGGCTGCCAGG + Exonic
1077411830 11:2407286-2407308 ACCTGGAACGTGTAGCTGCAGGG + Exonic
1078538883 11:12197783-12197805 AACTGTAACCAGTAGCTGCAGGG - Intronic
1083714412 11:64567511-64567533 ACCTCCCACCAGGAGCTGCCTGG - Intronic
1083904515 11:65661438-65661460 TCCTGACCCCTGTAGCTGGAAGG - Intronic
1088137981 11:106580281-106580303 ACATGACAACACTAGCTGTAGGG - Intergenic
1088474483 11:110221019-110221041 TCCTGACACCTGTCTCTGCATGG - Intronic
1089309289 11:117547338-117547360 ACAGAACCCCAGTAGCTGCACGG + Intronic
1091762806 12:3098237-3098259 ACCTGATTCCAGGAGTTGCAGGG + Intronic
1094455237 12:30624642-30624664 GTCTGACAGCAGCAGCTGCAAGG + Intergenic
1095721587 12:45407239-45407261 AGCTGACACAAGTAGTTGCCAGG + Intronic
1097099152 12:56574167-56574189 TCCTGACAGCAGTAACTTCATGG + Intronic
1097152459 12:56988972-56988994 ACCTAAAACCATTAGCTGCATGG + Intergenic
1098870833 12:75815178-75815200 ACCTGACACCAAGAACTGCTGGG + Intergenic
1101739928 12:107492889-107492911 ACCCAGCACCAGAAGCTGCAGGG - Intronic
1102583841 12:113909517-113909539 ACCTGACTCCAATGGCTGGAAGG + Intronic
1104848158 12:131857573-131857595 ACCCAACACCACTGGCTGCAGGG - Intergenic
1106155512 13:27151697-27151719 ACTTGAGACCAGGAGTTGCAAGG + Intronic
1122250927 14:100439137-100439159 ACCAGTCACCAGTGGGTGCAGGG - Intronic
1122865409 14:104601790-104601812 TCCTGACAGCAGGAGCTGCCCGG + Intronic
1123992380 15:25693433-25693455 ACCAGACACCAGTGGCTACGCGG + Intronic
1125263420 15:37852724-37852746 ACCTGACAGAAATAGCAGCATGG + Intergenic
1125432488 15:39609524-39609546 ACCCAACCCCAGCAGCTGCATGG + Intronic
1126286853 15:47022759-47022781 ACATGGTACCAGTATCTGCATGG - Intergenic
1126559460 15:50027213-50027235 ATTTGACAGCAGTAGGTGCAAGG - Intronic
1127784823 15:62346500-62346522 ACCTGACCCCACTAAGTGCAAGG + Intergenic
1128394775 15:67213192-67213214 AGTTGACACCAGTGGATGCATGG + Intronic
1130235019 15:82125484-82125506 AGCTGTCACCAGTAACTGCTGGG + Intergenic
1132047830 15:98579594-98579616 ACCTGACACCATGTGCTCCATGG - Intergenic
1134108791 16:11501835-11501857 GCCTGAGACCAGAAGCTGAAGGG - Intronic
1137439365 16:48484863-48484885 ATCTGACACCAGCAGGTGCTGGG + Intergenic
1139440576 16:66964624-66964646 TCCTGTCCCCAGTGGCTGCAGGG + Exonic
1141102398 16:81207613-81207635 ACTGGACACCATCAGCTGCAGGG + Intergenic
1146390449 17:32417397-32417419 GCCTGATAGCAGCAGCTGCAGGG + Intergenic
1155249127 18:23938735-23938757 ACCTGGGACCAGTGGCTGCCTGG - Intronic
1159957110 18:74526428-74526450 ACCTGAGAGGACTAGCTGCAGGG - Intergenic
1160093243 18:75846521-75846543 AGCAGACACCTATAGCTGCAGGG + Intergenic
1160616912 18:80137332-80137354 ACCTGACGGCAGGAGCTGGATGG - Exonic
1160699235 19:498097-498119 ACCGTACACAAGGAGCTGCACGG - Exonic
1162870005 19:13579170-13579192 ACTTGAAAGCAGAAGCTGCAAGG - Intronic
1165961989 19:39542561-39542583 ACCTTACAGCAGAAGCTGAAAGG + Intergenic
1166941393 19:46368346-46368368 ACTCGCCACGAGTAGCTGCATGG - Intronic
1167369862 19:49074027-49074049 ACCGGACACCAGTGGCTAGAAGG - Intergenic
1168016148 19:53574682-53574704 ACCAGACACCAGGTGCTTCATGG - Intronic
1168118504 19:54239592-54239614 ACCTGAGACCACGAGCTCCAGGG + Intronic
1168125034 19:54278258-54278280 ACCTGAGACCACGAGCTCCAGGG + Exonic
1168129969 19:54311862-54311884 ACCTGTCACCACCAGCTCCAGGG + Exonic
1168132422 19:54330030-54330052 ACCTGAGAACAGGAGCTTCAGGG + Intergenic
1168132433 19:54330098-54330120 ACCTGAGAACAGGAGCTTCAGGG + Intergenic
1168133638 19:54336839-54336861 ACCTGAGACCACGAGCTCCAGGG + Exonic
1168133903 19:54337934-54337956 ACCTGACACCAGTAGCTGCAGGG + Exonic
1168134005 19:54338394-54338416 ACCTGTCACCACCAGCTCCAGGG + Exonic
1168169100 19:54574562-54574584 ACCTGTCACCACCAGCTCCAGGG - Exonic
1168169451 19:54576089-54576111 ACCTGAGACCACGAGCTCCAGGG - Exonic
1168171882 19:54594932-54594954 ACCTGTCACCACCAGCTCCAGGG - Exonic
1168172231 19:54596471-54596493 ACCTGAGACCATGAGCTCCAGGG - Exonic
1168176608 19:54631767-54631789 ACCTGTCACCACCAGCTCCAGGG - Exonic
1168176952 19:54633298-54633320 ACCTGAGACCACGAGCTCCAGGG - Exonic
1168185770 19:54698477-54698499 ACCTGAGACCACGAGCTCCACGG - Intronic
1168187392 19:54708866-54708888 ACCTGTCACCACCAGCTCCAGGG - Intergenic
1168187744 19:54710389-54710411 ACCTGAGACCACGAGCTCCAGGG - Intergenic
925362021 2:3286356-3286378 ACTTGACACCTGGAGCTGAACGG - Intronic
925992261 2:9263171-9263193 ACATGACACCAGAAGGTGCTGGG - Intronic
926319552 2:11739366-11739388 TCCTGACACAAGAAACTGCAGGG + Intronic
926636880 2:15189655-15189677 AGCTGCCACCCGTAGCTGCGTGG - Intronic
927235559 2:20871388-20871410 AGCTGACACGAGAAGATGCAGGG + Intergenic
929814210 2:45218761-45218783 AAATGACACCAGTAGATGTAAGG - Intergenic
930014984 2:46964062-46964084 AGGTTACACCAGTAGTTGCAGGG + Intronic
930996533 2:57726122-57726144 ACATGAAAGCAGTAGCTGGAAGG - Intergenic
932407363 2:71522340-71522362 CCCTTACACCAGTGGCTTCAGGG - Intronic
933609003 2:84414865-84414887 ACCTGTCACCAGCAGATGCCTGG + Intergenic
934093319 2:88574270-88574292 CCCTGACACCAATACCTCCAGGG - Intronic
936080135 2:109427500-109427522 GCCTTACACCAGGAGCTCCAGGG + Intronic
942219382 2:173754708-173754730 CACTGACACCAGTAGCTGGGAGG + Intergenic
943043815 2:182834166-182834188 AACTGAAACCAGTAGCCGCTGGG - Exonic
944130760 2:196345384-196345406 ACATGTCACCATTAGCTGGATGG - Intronic
945657202 2:212639358-212639380 ACATCACACCAGTAGCTTCAGGG + Intergenic
946600038 2:221349598-221349620 ACCAGACACCAGTGGCCCCAGGG + Intergenic
1168868723 20:1110663-1110685 GCATGACACCAGTATCTGCTTGG - Intergenic
1170556410 20:17518556-17518578 ACCAGACACCAGGATCTCCAAGG - Intronic
1171233794 20:23508639-23508661 GCCTGACACCAGTCCCTCCATGG - Intergenic
1173322649 20:42002035-42002057 AACTGACACAAGAAGCTGCTGGG - Intergenic
1176959184 21:15140278-15140300 AAGTGACACCAGTCGCTGCCTGG + Intergenic
1178328210 21:31662545-31662567 ACCTGTCACCATTACCTGAATGG + Intronic
1181090113 22:20466811-20466833 ACTTGACTCCAGTAAGTGCAGGG + Intronic
1184123412 22:42469124-42469146 ACCTGACCCCAGTTGCTCCCAGG - Intergenic
1185238048 22:49725911-49725933 ACCTGACACGCGGAGTTGCAGGG - Intergenic
949308797 3:2672855-2672877 GCCTTAAACCAGTAGCTGGATGG - Intronic
949991204 3:9580695-9580717 ACCACACAGCAGAAGCTGCAAGG - Intergenic
950798422 3:15530189-15530211 ACCTGACCCCAGTGGCTTCTTGG - Intergenic
952152436 3:30607119-30607141 GCCCGACTCCCGTAGCTGCAGGG + Intronic
955326784 3:58014682-58014704 CCCTGCCTCCAGTAGCTCCATGG + Intronic
960291928 3:115896492-115896514 AGATGAAATCAGTAGCTGCAAGG + Intronic
962631573 3:137281464-137281486 ACCTGAGGCCAGTAAGTGCAGGG + Intergenic
963056909 3:141193575-141193597 GCCAGACACCAGTAGCAGCATGG + Intergenic
963123343 3:141794304-141794326 GCCTGGCACCAGCAGCTGGAGGG + Intronic
963682700 3:148400140-148400162 ACATGACACCAGCATCTGCTTGG + Intergenic
964398565 3:156273571-156273593 ACCCCACAGCAGCAGCTGCATGG - Intronic
964485385 3:157180358-157180380 ACCTGACACCACAAGAAGCAGGG - Intergenic
965368931 3:167836417-167836439 ACCAGACAGCAGTCACTGCATGG + Intergenic
965778064 3:172254781-172254803 ACATCACACCATTAGCTCCAAGG - Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
966862182 3:184236663-184236685 ACCTGCCACCAGCTGCTCCAGGG + Exonic
967636134 3:191804946-191804968 ACCTGAAACCTGGGGCTGCAGGG - Intergenic
972558981 4:40209526-40209548 ACCTGACCCCAGGAGGTGGAAGG - Intronic
975572564 4:75832780-75832802 TCCAGCCACCAGAAGCTGCAAGG - Intergenic
975870960 4:78777146-78777168 GCTTGACACCAGGGGCTGCAGGG - Intronic
980023500 4:127737165-127737187 ACCTGACACCTGGAGCTTCAGGG + Intronic
980177818 4:129368018-129368040 ATCTGACAACAGTAATTGCAAGG - Intergenic
980838858 4:138232360-138232382 ATATCACAGCAGTAGCTGCAGGG + Exonic
987476967 5:18402272-18402294 ACATGGCACCAGTATCTGCTTGG - Intergenic
988357237 5:30193740-30193762 AGCAGACAGCAGAAGCTGCATGG + Intergenic
989116606 5:37960050-37960072 ACGTGACAGCAGTAGCTCAAAGG + Intergenic
991027145 5:62042231-62042253 ACCTGAAGCCAGCAGCAGCAAGG + Intergenic
1002756141 6:162006-162028 ACCTCACACCAGGACCTGCAGGG + Intergenic
1003920326 6:10826718-10826740 ACATGGCACCCCTAGCTGCAGGG - Intronic
1004460174 6:15828095-15828117 ACCTGGCACTAGGGGCTGCAGGG + Intergenic
1007109071 6:39302696-39302718 AGCTGAGCCCAGTAGCTCCAAGG - Intronic
1012443765 6:99288001-99288023 ATCTGACACCATCATCTGCACGG - Intronic
1012589639 6:100964977-100964999 TCCTGGCACCATTAGCTCCATGG - Intergenic
1013256046 6:108386746-108386768 ATGTGACACCAGTAGCAGAAAGG + Intronic
1014536108 6:122614903-122614925 ACCTGGCTCCAGAAGCTCCATGG - Intronic
1020482818 7:8683079-8683101 ACATGACACCAGCATCTGCTTGG + Intronic
1020535418 7:9389972-9389994 ACCTGTCACCTCTAGCAGCATGG - Intergenic
1023329198 7:39096104-39096126 ACTTCACATCAGTATCTGCACGG + Intronic
1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG + Intergenic
1033772303 7:144566005-144566027 ACATGAAACCATTACCTGCATGG - Intronic
1034293230 7:149948630-149948652 ACCTGACACCAGCAACTGCCCGG - Intergenic
1034621065 7:152457429-152457451 GCGTGACACCAGTATCTGCCTGG - Intergenic
1037976683 8:23219027-23219049 ACTTGACTCCAGCAGTTGCAAGG - Intronic
1038245160 8:25848483-25848505 ACCTGACTTCAGTAACAGCACGG + Intronic
1042549472 8:69981519-69981541 ACCTGACAGGATCAGCTGCATGG - Intergenic
1044579281 8:93807165-93807187 ACCTGCCACCAGTAGCTTTGTGG - Intronic
1046184076 8:110690346-110690368 CCCTCACACCTGCAGCTGCATGG + Intergenic
1049814199 8:144590637-144590659 GCCTGACACGAGTGACTGCAAGG + Intronic
1050876957 9:10651162-10651184 ACCCCACACCCCTAGCTGCAGGG + Intergenic
1052298039 9:26920781-26920803 AGCTGATAGCAGTAGCTGAAGGG - Intronic
1052405917 9:28060715-28060737 ACCTGACACCAGCATCTGAAAGG + Intronic
1052729251 9:32266093-32266115 ACCTTAGACCAGTAGCTTCCAGG + Intergenic
1057311666 9:93946978-93947000 ATCTGACATCAGTGGCAGCATGG - Intergenic
1062281634 9:135754530-135754552 ACCTGTCCCCAGAACCTGCAAGG + Intronic
1185495689 X:553295-553317 CCCTGCCACCAGCAGCTGCCAGG - Intergenic
1186352797 X:8757216-8757238 AACTGACCCCAGTGCCTGCAAGG + Intergenic
1189581047 X:42406732-42406754 ACCTGACCCAAGTAGTTGAAAGG - Intergenic
1194920313 X:99757840-99757862 ACCTGGCAGCAGTGGCAGCACGG + Intergenic
1196170565 X:112583960-112583982 ACATGGCACCAGCATCTGCATGG + Intergenic
1198010828 X:132551925-132551947 ACATGGCACCAGTATCTGCTTGG - Intergenic
1199680354 X:150220150-150220172 TCCTGGAACCAGTACCTGCAAGG + Intergenic