ID: 1168138665

View in Genome Browser
Species Human (GRCh38)
Location 19:54369517-54369539
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 2, 1: 0, 2: 3, 3: 40, 4: 496}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168138665_1168138672 10 Left 1168138665 19:54369517-54369539 CCCTCCACCTTTGCATTCCTCTA 0: 2
1: 0
2: 3
3: 40
4: 496
Right 1168138672 19:54369550-54369572 TCTGAGACTCTCCTCCAAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168138665 Original CRISPR TAGAGGAATGCAAAGGTGGA GGG (reversed) Intronic
900752086 1:4404859-4404881 AAAAGGAATGCAAAGCTGGGAGG - Intergenic
900834211 1:4987641-4987663 TAGAGGAAGGGAAGGCTGGAAGG - Intergenic
900993602 1:6108848-6108870 TAGAGGGATGGAGGGGTGGAAGG + Intronic
901180817 1:7340704-7340726 TGGATGGATGCACAGGTGGAAGG - Intronic
901242337 1:7702935-7702957 TAAAGGAATCAATAGGTGGAAGG - Intronic
901858927 1:12062268-12062290 TGGATGGATGCATAGGTGGATGG - Intergenic
901858970 1:12062463-12062485 TGGATGGATGCATAGGTGGATGG - Intergenic
901858991 1:12062559-12062581 TGGATGGATGCATAGGTGGATGG - Intergenic
901859035 1:12062758-12062780 TGGATGGATGCATAGGTGGATGG - Intergenic
901859058 1:12062862-12062884 TGGATGGATGCATAGGTGGATGG - Intergenic
902206576 1:14872773-14872795 CAGATGAATGGATAGGTGGATGG + Intronic
902206643 1:14873109-14873131 TAGATGAATGGATGGGTGGATGG + Intronic
902206655 1:14873165-14873187 TAGATGAATGGATGGGTGGATGG + Intronic
902398054 1:16143094-16143116 TAGATGAATGGACAAGTGGATGG + Intronic
903030552 1:20461062-20461084 TAGATGGATGGATAGGTGGATGG + Intergenic
903747117 1:25595040-25595062 TAGATGAATGGACAGGTGAATGG - Intergenic
904251999 1:29231533-29231555 TAGAGGAATGCTATTGTGGGTGG + Intergenic
904464471 1:30699746-30699768 TAGAGGGATGGAAGGATGGATGG - Intergenic
904936869 1:34137129-34137151 TGGAAGAATGGATAGGTGGATGG - Intronic
905083121 1:35343110-35343132 CAGATGAATGCATAGATGGATGG - Intronic
907722078 1:56981456-56981478 TGAAGGAATGCACAGGTGGAGGG - Intergenic
907946771 1:59142826-59142848 TGGATGAATGGAAAGGTGGGTGG + Intergenic
908254352 1:62290698-62290720 TAGATGGATGCATGGGTGGATGG + Intronic
908842871 1:68296307-68296329 TACAGGAAGGCAAAGGTTGTGGG - Intergenic
911127821 1:94357410-94357432 TAGATGAATGGATAGATGGATGG + Intergenic
911171779 1:94777404-94777426 TAGATGAATGAAGAAGTGGATGG + Intergenic
911330443 1:96520192-96520214 GCAAGGAATGCAAAGGGGGAGGG - Intergenic
912672143 1:111640145-111640167 AAGAAGTAGGCAAAGGTGGAGGG - Intronic
913098899 1:115545258-115545280 GAGGGGAATGCAAAGGCGGCAGG + Intergenic
913300430 1:117364213-117364235 TAGAGGAAAGCAAGATTGGAAGG + Intergenic
914245873 1:145885562-145885584 TTGAGGAAGGCAAAGCTGGCGGG + Intronic
914443816 1:147732259-147732281 TAGAGAAATGCAAATCTGGCTGG - Intergenic
915161291 1:153922609-153922631 TGGGGGAAGGGAAAGGTGGAGGG - Intronic
915198204 1:154206257-154206279 AAGAGGTATGCAGAGTTGGAAGG - Exonic
915494514 1:156272195-156272217 TAGGGGAATGCTAAGATTGAAGG - Intronic
916212466 1:162369994-162370016 TAGAAGAATGAAAAAGAGGAAGG - Exonic
917360574 1:174171045-174171067 TAGAGGAATGCAGAAATGTAGGG + Intronic
918200471 1:182261440-182261462 TATAAGAATGCAAATGTGGCCGG - Intergenic
919845372 1:201639124-201639146 CAGAGCAAAGCAAAGGTGCAGGG + Intronic
920676383 1:208041256-208041278 TAGAGGAAGGCTAAAGAGGAGGG + Intronic
921179652 1:212621990-212622012 TAGAGGAAAGGGAAGGTGGGGGG + Intergenic
921219739 1:212964821-212964843 TGGATGGATGGAAAGGTGGATGG - Intronic
922188652 1:223297891-223297913 TAGATGGATGGACAGGTGGATGG + Intronic
923318691 1:232806349-232806371 TAGTGTAATACAAAGGAGGAGGG - Exonic
1063299864 10:4841819-4841841 AAGAGGATTGCAAAGGAGCACGG + Exonic
1063590143 10:7387632-7387654 AAGAGGAAACCAAAGGAGGATGG + Intronic
1063781325 10:9328417-9328439 AGGAAAAATGCAAAGGTGGAAGG - Intergenic
1064755648 10:18569997-18570019 TAGTGGAATGCAATGGAGAATGG - Intronic
1065665669 10:28057489-28057511 TGGCGGAAAGCAAAGGAGGAGGG - Intronic
1065860782 10:29870838-29870860 TAGATGAATGAATAGATGGAGGG - Intergenic
1067694855 10:48527410-48527432 TAGATGAATGGATGGGTGGATGG + Intronic
1070727014 10:78799345-78799367 CAGAGGAAAGAAAAGGTAGAAGG - Intergenic
1071506381 10:86234187-86234209 TGGAGGAAGGAAAAGGGGGATGG - Intronic
1072517940 10:96204834-96204856 TGGATGAATGCAGAGGTGGTAGG - Intronic
1073592105 10:104767552-104767574 GAGAGGAAGGGAAAGGGGGAAGG - Intronic
1073617527 10:105011742-105011764 AAGAGGAATGGAAACGTGAAAGG - Intronic
1074364050 10:112844014-112844036 TAGAGGAATGCCAAGGCATAGGG + Intergenic
1074366260 10:112859873-112859895 TAGATGAATGGATAGATGGATGG + Intergenic
1074525785 10:114261932-114261954 TGGCGGAAGGCAAAGGTGGGGGG + Intronic
1076798441 10:132809907-132809929 AAGAGGAATGCATGGGTTGAGGG - Intronic
1077288073 11:1776311-1776333 GAGGGGGATGCAGAGGTGGATGG + Intergenic
1077294893 11:1821694-1821716 TAGATGAATGGATGGGTGGATGG + Intergenic
1077515933 11:3002189-3002211 AAGGGGAAAGCCAAGGTGGAGGG + Intronic
1077904719 11:6521539-6521561 TAGGGGAATGAAAAGATAGAAGG + Intronic
1077955778 11:7019097-7019119 AAGAGGAACACAAAGGAGGAAGG - Intronic
1077990396 11:7404817-7404839 AAAAGGAATGCAAAAGTGCACGG + Intronic
1078357572 11:10643716-10643738 TGGATGGATGGAAAGGTGGATGG - Intronic
1078740467 11:14061388-14061410 TAGATGACTGGATAGGTGGATGG - Intronic
1079023005 11:16924526-16924548 TTTAGGAAGGCAAAGGAGGAGGG + Intronic
1079329266 11:19520596-19520618 TAGAGGATGGGAAAGGAGGAAGG - Intronic
1079554271 11:21739991-21740013 GAGAGGGACGCAAAGGGGGAAGG + Intergenic
1080571404 11:33560163-33560185 AAGAGAAATGCAAAGGACGAAGG - Intronic
1080826802 11:35855534-35855556 TAGAGGATTGGAAAGGGAGAAGG - Intergenic
1081677580 11:44979895-44979917 TGGAGGCATGAAAAGGTGGAGGG + Intergenic
1081852954 11:46286227-46286249 TAGAGGAATGAATAGGTGGGTGG + Intronic
1083025997 11:59551337-59551359 TAGAGAAATTCAAAGGTTGTGGG + Intergenic
1083634806 11:64114768-64114790 TGGATGAATGTACAGGTGGATGG + Intronic
1083853554 11:65381045-65381067 GAGAGGAAGGCACAGGTGGGAGG - Intronic
1084713031 11:70855980-70856002 TAGATGAATGGATAGATGGATGG + Intronic
1084781811 11:71414832-71414854 TAGATGGATGGATAGGTGGATGG + Intergenic
1084792944 11:71486327-71486349 TAGATGAATGGACAGATGGATGG - Intronic
1086008805 11:82073251-82073273 GAAAGTAAGGCAAAGGTGGAGGG - Intergenic
1086816348 11:91377199-91377221 TAGAAGAATGAATAGATGGATGG + Intergenic
1087920627 11:103862738-103862760 AAGAGGAATGAAAAGAAGGAGGG - Intergenic
1089175805 11:116547975-116547997 AAGAGGGAGGCACAGGTGGAGGG - Intergenic
1089810127 11:121124942-121124964 TAGAGGAATGCAGAGGAAAAGGG + Intronic
1090012269 11:123055735-123055757 TGGGAGAATGCAAAGGTGGGAGG + Intergenic
1090165871 11:124546383-124546405 TAGTGGAATGAAAAAGTGTAAGG + Intergenic
1091040740 11:132278565-132278587 AAGTGGAATGCAAGGGTGCAGGG + Intronic
1091117845 11:133031356-133031378 TAGATGAATGAGTAGGTGGATGG + Intronic
1091367567 11:135035348-135035370 TAGATGAATGCATGGTTGGATGG + Intergenic
1092010640 12:5108824-5108846 TGGAGGCTTGCAAAGGTGGGAGG + Intergenic
1094760591 12:33528028-33528050 TTGAGATATGCAAAGGTGAATGG - Intergenic
1095651153 12:44610782-44610804 TAGAGGAAGGTAGAGATGGATGG + Intronic
1095946954 12:47758984-47759006 TAGAGGAATGCGTAGGGGAAGGG + Intronic
1098429354 12:70402701-70402723 AGGAGAAATGCACAGGTGGACGG + Intronic
1101786020 12:107884310-107884332 TAGAGGGAGGCGGAGGTGGAAGG - Intergenic
1101805937 12:108063751-108063773 AAGAGCAATGCATAGGTGGATGG + Intergenic
1102292426 12:111712004-111712026 TAGAGGAAAACAAAGGAAGAAGG - Intronic
1102451253 12:113043642-113043664 TAGAGGAAGGCACTCGTGGAGGG - Intergenic
1102514768 12:113439065-113439087 TAGAGGAATGGATGGATGGACGG - Intergenic
1102627709 12:114249092-114249114 AAGAAGAATGCAAGGGAGGAGGG - Intergenic
1102636884 12:114332438-114332460 TCGGGGAATGCAAAGGGGGCTGG - Intergenic
1102920762 12:116789683-116789705 TAGAGGGATGGATGGGTGGATGG + Intronic
1103004381 12:117409452-117409474 TAGAGGGATGGATGGGTGGATGG + Intronic
1103004424 12:117409610-117409632 TAGGTGAATGGAGAGGTGGAGGG + Intronic
1103007273 12:117431443-117431465 TAGATGAATGCAAGGATAGATGG + Intronic
1103206010 12:119129750-119129772 TAAAGGAATGAATAGATGGATGG + Intronic
1103361408 12:120356608-120356630 TAGAGGAATGGACAGATGGAGGG + Intronic
1103735961 12:123061048-123061070 TGGATGAATGCATGGGTGGATGG - Intronic
1103940904 12:124500697-124500719 GAGAGGAATGCAGGGGTGGGAGG - Intronic
1104083573 12:125455177-125455199 TGGAGGAAATGAAAGGTGGAAGG + Intronic
1106057225 13:26249830-26249852 TAGAGGAATGAATGGATGGATGG - Intergenic
1106386187 13:29288422-29288444 TTGAGGAATGGAAAGGGGAAGGG + Intronic
1107337378 13:39369618-39369640 GAGAGGAAAGGAAAGGGGGAAGG - Intronic
1107836512 13:44416213-44416235 TTTAGGAATGAAAGGGTGGATGG - Intergenic
1108304119 13:49113638-49113660 ATGAGGAATGTAAAGGGGGAAGG - Intronic
1109511664 13:63384320-63384342 GAGAGGGAAGCAAAGGAGGAGGG - Intergenic
1110317363 13:74125837-74125859 TAGAATAAAGCAAAAGTGGAAGG - Intronic
1112572559 13:100607185-100607207 TTAAGGAATGCGAAGGTGGATGG - Intronic
1113021709 13:105894846-105894868 TGGAAGAATGAAAAGGAGGAAGG - Intergenic
1113598382 13:111550292-111550314 TAGATGAATGGAAAAATGGATGG - Intergenic
1113641438 13:111960211-111960233 TAGATGAATGAATAGATGGATGG + Intergenic
1113641480 13:111960583-111960605 TAGATGAATGAATAGATGGATGG + Intergenic
1116374968 14:44187421-44187443 TAGAGGAAAGAAATGGGGGAGGG - Intergenic
1116819876 14:49617581-49617603 TAGAGGAATGCAAAGGGCTAGGG - Intergenic
1117268152 14:54112576-54112598 TAGAGGATGGGAAAGGTAGAGGG + Intergenic
1117445306 14:55798593-55798615 AAGAGGAAGGCAAAGGTGTTTGG + Intergenic
1118706225 14:68483014-68483036 TAGGGGAAGGGAAAGGTGGATGG + Intronic
1118782312 14:69017060-69017082 TAAAGGAATGCAAAGGGGCCGGG - Intergenic
1119281158 14:73409290-73409312 GAGAGGAAGGCAAAGGTGCATGG - Intronic
1120473441 14:84956752-84956774 TGGATGAATGGATAGGTGGATGG + Intergenic
1120797312 14:88648695-88648717 TAGAAGAAAGCACAGGAGGAAGG - Intronic
1121385183 14:93514644-93514666 TAAAGAAATGCTAAGGCGGATGG - Intronic
1121517840 14:94565111-94565133 TAGAGGAAAGAAGAGTTGGAAGG + Intronic
1121606618 14:95245537-95245559 TGGATGAATGGATAGGTGGATGG + Intronic
1121815971 14:96928944-96928966 TAGATGGATGGATAGGTGGAGGG - Intronic
1121824932 14:97002416-97002438 TAGATGAATGGATAGGTGGATGG - Intergenic
1121914379 14:97822829-97822851 TAGGCGGATGCAAAAGTGGATGG + Intergenic
1122011523 14:98753010-98753032 TGGATGAATGCATTGGTGGATGG + Intergenic
1122123775 14:99568408-99568430 GAGAGGAAGGCCAAGGAGGAAGG - Intronic
1122958515 14:105083794-105083816 TAGAGGAATGGATGGGTGGAGGG - Intergenic
1123061107 14:105594892-105594914 TAGGGGAATGAAGAGGGGGATGG + Intergenic
1123085562 14:105715803-105715825 TAGGGGAATGAAGAGGGGGATGG + Intergenic
1123131413 14:105988580-105988602 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123581646 15:21719777-21719799 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123618295 15:22162400-22162422 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1126278974 15:46919892-46919914 TACAGGAATGCAATGTTGGATGG + Intergenic
1126303811 15:47231124-47231146 AAGAGGAAAGCAGAGGAGGAAGG - Intronic
1126386553 15:48099371-48099393 TAAAGGAATGAAAAGGAGAAAGG + Intergenic
1126799793 15:52288585-52288607 TAGAGGAATGTGAGGGAGGAGGG - Intronic
1127052391 15:55098246-55098268 TAGAGAAAAGCAGAAGTGGAGGG - Intergenic
1127639037 15:60897952-60897974 TAGAAGGAGGTAAAGGTGGAGGG - Intronic
1127694823 15:61434855-61434877 TAGAGGAATGCAATGCTGTGTGG - Intergenic
1128194818 15:65743110-65743132 TGGCGGGAAGCAAAGGTGGAAGG - Intronic
1128519000 15:68363143-68363165 TAGATGAATGCATGGGTGGTTGG + Intronic
1128734117 15:70042672-70042694 TCGATGAATGGATAGGTGGATGG - Intergenic
1128975654 15:72151314-72151336 TAGATGAAGTCAAAGGGGGAGGG - Intergenic
1129158641 15:73734321-73734343 CAGAGAAATGGAAAGGGGGAAGG + Intergenic
1129598527 15:76983312-76983334 GAGAGGAGTGCCAAGGTGGGAGG + Intergenic
1129681474 15:77660804-77660826 TAGAGGAATGCACAGAGGCAGGG + Intronic
1129889661 15:79063549-79063571 TAGAGGAATGCAAGGATGGATGG - Intronic
1129998972 15:80031023-80031045 TAGATGATTGCATAGGTTGATGG - Intergenic
1129998974 15:80031047-80031069 TAGATGATTGCATAGGTTGATGG - Intergenic
1130207004 15:81886306-81886328 TGGATGAATGCATGGGTGGATGG + Intergenic
1130678890 15:85979282-85979304 TAGAGGAACACGCAGGTGGAAGG - Intergenic
1131305634 15:91240752-91240774 TACGGGAATGCAAATGTGGATGG - Intronic
1131665540 15:94567806-94567828 TAGAGGAATCCCAAGGCTGAAGG + Intergenic
1132653681 16:1032674-1032696 TGGATGGATGCATAGGTGGAAGG - Intergenic
1132654043 16:1034400-1034422 TAGATGGATGGACAGGTGGATGG - Intergenic
1132738619 16:1399563-1399585 CAGAGGAGACCAAAGGTGGAAGG + Intronic
1133511490 16:6462209-6462231 TGGAGGACTGCGAAGGTAGATGG - Intronic
1135176927 16:20238428-20238450 TGGATGAATGGAAGGGTGGAAGG - Intergenic
1135636154 16:24077375-24077397 GAGATGAATGCATGGGTGGATGG - Intronic
1135669550 16:24363384-24363406 TGGGGGAATGGGAAGGTGGATGG + Intergenic
1135793070 16:25416142-25416164 TAGATGAATGGAAGGATGGATGG - Intergenic
1135793209 16:25417523-25417545 AAGATGAATGGATAGGTGGATGG - Intergenic
1135893024 16:26374271-26374293 TAGATGAGTGAATAGGTGGATGG + Intergenic
1136024131 16:27459177-27459199 TAGATGAATGCACAGATGAATGG + Intergenic
1136071302 16:27789019-27789041 TAGATGGATGCACAGCTGGATGG + Exonic
1136265284 16:29113429-29113451 AAGAGGAAGGCACAGCTGGAAGG - Intergenic
1136598805 16:31270125-31270147 GAAAGGAAAGCAAAGGAGGAAGG - Intronic
1137561686 16:49506463-49506485 TAGATGAATGAATAGATGGATGG + Intronic
1137561710 16:49506597-49506619 TAGATGAATGAATAGATGGATGG + Intronic
1137728439 16:50672656-50672678 TAAAGCAATTCCAAGGTGGAAGG + Exonic
1138077312 16:54055450-54055472 TAGAGGTCTGCAAAGGTGCAGGG + Intronic
1139232176 16:65294342-65294364 TGCAGGAATGCAATGGGGGAAGG + Intergenic
1139310546 16:66024716-66024738 TAGATGGATGGATAGGTGGATGG - Intergenic
1139310572 16:66024832-66024854 TGGAGGTATGGATAGGTGGATGG - Intergenic
1139315959 16:66069002-66069024 TAGGGGAATGAATGGGTGGATGG + Intergenic
1139326964 16:66160198-66160220 GAGAGGAAAGCACAGCTGGAAGG + Intergenic
1139946301 16:70644798-70644820 AGGAGGAATGAAAAGGAGGAAGG + Intronic
1140032324 16:71348626-71348648 GAGAGGAAGACAGAGGTGGAGGG - Intergenic
1140852471 16:78947983-78948005 TAGAGGAAGTCAAAGGCAGAGGG + Intronic
1140865589 16:79058487-79058509 AAGAGGGATGGAAAGGAGGAAGG + Intronic
1140904452 16:79398487-79398509 AAGAGGAATGAGAAGATGGAGGG + Intergenic
1141096839 16:81168768-81168790 TAGATGAATGAATAGGTGGATGG + Intergenic
1141819815 16:86437558-86437580 TAGAAGGATGGAATGGTGGACGG - Intergenic
1142054088 16:87981361-87981383 AAGAGGAAGGCAGAGCTGGAAGG - Intronic
1143627742 17:8120970-8120992 TAGAGCAATTCAAAGGTTGTGGG + Exonic
1143769171 17:9157033-9157055 TGGAAGGATGAAAAGGTGGATGG - Intronic
1144073467 17:11695280-11695302 TTGAGGATGGCAAAGGTGGAAGG + Intronic
1144499664 17:15774654-15774676 TAGAAGAATGGATAGGAGGATGG - Intergenic
1145261416 17:21356943-21356965 TAGATGAATGGATAAGTGGATGG - Intergenic
1145261445 17:21357101-21357123 AAGAGGGATGTAAAGATGGATGG - Intergenic
1145271497 17:21407236-21407258 TAGAGGGATGGAAGGGTGGATGG - Intronic
1145309711 17:21694684-21694706 TAGAGGGATGGAAGGGTGGATGG - Intronic
1146805224 17:35859536-35859558 TGGAGGAGTGCAAAGGTGGCAGG - Intronic
1146924191 17:36732709-36732731 TAGATGGATGCAAGGGTGGATGG - Intergenic
1147051008 17:37794930-37794952 TAGTGTAATGCCAAGGTGTAAGG - Intergenic
1147295401 17:39478138-39478160 TTTAGGGATGCCAAGGTGGAAGG - Intronic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149453739 17:56770558-56770580 TAGATGGATGAAAGGGTGGATGG - Intergenic
1150447523 17:65238733-65238755 TAGAGGAATTGACAGATGGATGG - Intergenic
1150447611 17:65239404-65239426 TAGAGGAGTGCATAGATGGATGG - Intergenic
1150947363 17:69762543-69762565 TACAGGAATGGAATGATGGATGG + Intergenic
1152006611 17:77686127-77686149 TAGAAGGATGGAGAGGTGGAGGG - Intergenic
1152285057 17:79407689-79407711 TGCAGGATTGCAAAGGAGGAAGG + Intronic
1153190164 18:2529248-2529270 TAGTGGCAGGCAGAGGTGGAGGG + Intergenic
1153481961 18:5555878-5555900 AAGAGGAATGGAAAGATGGCTGG - Intronic
1153944588 18:10008095-10008117 TGGATGGATGGAAAGGTGGATGG - Intergenic
1156205020 18:34875904-34875926 TAGAGGAGTACAAAGAGGGATGG + Intronic
1156225099 18:35097370-35097392 TAGAGGACTGCTAGGCTGGAAGG - Intronic
1156471677 18:37381006-37381028 TAGAGGAATGGATAGATGGATGG - Intronic
1156471682 18:37381043-37381065 TAGAGGAATGGATGGATGGATGG - Intronic
1156721123 18:40071125-40071147 TAGAGGAAGGCAAAGGGGGAGGG - Intergenic
1158992983 18:62889234-62889256 GGGAGGAATGCAAAGGGGGTGGG + Intronic
1159773652 18:72578898-72578920 TAGAAGAATTGAAAGGTGAAGGG - Intronic
1160102524 18:75936412-75936434 TAGAGGAATACACAGATTGAAGG + Intergenic
1160177047 18:76603457-76603479 TTGAGGACTTCAAAGGTGGTGGG + Intergenic
1160297343 18:77650459-77650481 TAGATGAATGGATGGGTGGATGG - Intergenic
1160544319 18:79642493-79642515 AACAGGAATGCAGAGGTGGATGG + Intergenic
1160687394 19:443175-443197 TAGATGAGTGCATGGGTGGATGG + Intronic
1161258507 19:3322852-3322874 TAGAGGGATGGATGGGTGGATGG + Intergenic
1161258555 19:3323052-3323074 TAGAGGGATGGATGGGTGGATGG + Intergenic
1161489450 19:4553853-4553875 TAGATGGATGGATAGGTGGATGG + Intronic
1161641050 19:5423645-5423667 TGGATGAATGGATAGGTGGATGG - Intergenic
1161695195 19:5763027-5763049 TAGAGAGATGGAAGGGTGGATGG + Intronic
1161852250 19:6743685-6743707 CTGAAGAATGCAGAGGTGGAAGG - Intronic
1161933796 19:7358436-7358458 TAGATGGATGGATAGGTGGATGG - Intronic
1162155922 19:8677898-8677920 TAGATAAATGGAAAGGAGGAAGG - Intergenic
1163350497 19:16773867-16773889 TAGATGAATGGAAGGGTGGGAGG - Intronic
1163492611 19:17625609-17625631 TGGATGAATGGACAGGTGGATGG - Intronic
1164650950 19:29890881-29890903 TAGATGGATGCATGGGTGGATGG - Intergenic
1164650991 19:29891063-29891085 TAGATGGATGCATGGGTGGATGG - Intergenic
1164651024 19:29891217-29891239 TAGATGGATGCATGGGTGGATGG - Intergenic
1164908753 19:31988479-31988501 TAGATGAATGGATAGATGGATGG - Intergenic
1165227986 19:34367572-34367594 GAGAGGCTTGCTAAGGTGGAGGG - Intronic
1165965980 19:39581250-39581272 GAGAAGAAAGCAAAGGAGGAAGG + Intergenic
1167144079 19:47671813-47671835 TGGAGGGATGAATAGGTGGATGG + Intronic
1167277697 19:48548818-48548840 TAGAGGGATGAACAGCTGGAGGG + Intergenic
1167387640 19:49173417-49173439 TGGATGAATGAAAAGATGGATGG - Intronic
1168138665 19:54369517-54369539 TAGAGGAATGCAAAGGTGGAGGG - Intronic
1168159411 19:54499266-54499288 TAGAGGAATGCAAAGGTGGAGGG + Intronic
1168366946 19:55796471-55796493 GAGATGAATGCAAAAGAGGAAGG - Intronic
1168414261 19:56158832-56158854 TAGAGGAATGGATAGGTGGAGGG - Intronic
1168472163 19:56648536-56648558 TAGAGGGATGAATAGGTGGGTGG - Intronic
925208019 2:2023646-2023668 TAGAGGACTGAATAGTTGGATGG + Intronic
926038301 2:9652403-9652425 TAGATGGATGAATAGGTGGATGG - Intergenic
926523295 2:13944638-13944660 TAGGTGGATGCACAGGTGGAAGG - Intergenic
926698634 2:15787967-15787989 TAGATGAATGGACAGATGGATGG - Intergenic
927073110 2:19550076-19550098 TAGAGGAGGGACAAGGTGGAAGG - Intergenic
927994360 2:27472745-27472767 AAGAGCACTGCAAGGGTGGATGG + Intronic
929997349 2:46836982-46837004 TAGAGGCAGGCAAAGGTGGTAGG + Intronic
930096180 2:47569003-47569025 AAGAGGAATGAAGGGGTGGATGG + Intronic
930146250 2:48008015-48008037 AAGAGGAAAGGAAAGGAGGAAGG - Intergenic
931010181 2:57902822-57902844 TTGAGGAATGGAATGGTGAAGGG + Intergenic
931316834 2:61140854-61140876 CAGAGGAAGGAATAGGTGGAAGG + Intergenic
931766571 2:65462052-65462074 TGGAAGAAAGCAAAGGTAGATGG - Intergenic
933271592 2:80238717-80238739 TAGAGGGATGGAATGGGGGAAGG + Intronic
933496703 2:83058867-83058889 AATAGTAATGCAAAGGTAGAAGG + Intergenic
935746099 2:106191658-106191680 TCTAGGAATGCAAAGAAGGATGG - Intronic
935819170 2:106876982-106877004 TAGAGGAAAAAAAAGGTGGTAGG + Intronic
937229103 2:120386980-120387002 TAGATGGATGGATAGGTGGATGG - Intergenic
937639822 2:124199172-124199194 TAAAGGGAAGCAAAGCTGGAAGG + Intronic
937857617 2:126683934-126683956 TAGAGGCCTGCAAAGGTGAGGGG - Intronic
937871987 2:126792575-126792597 TAGAGCAAGGGAAAGGAGGAAGG - Intergenic
938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG + Exonic
938824213 2:134989132-134989154 TAGAGGAGGGCAAAGGAGAAAGG - Intronic
939861623 2:147427776-147427798 AAGAGGACTGGAAATGTGGAAGG - Intergenic
941163303 2:162059094-162059116 TAAAGAAATGCAAGGCTGGAAGG + Intronic
942231245 2:173862627-173862649 TGGAGGAATGTAAAGCAGGAAGG + Intergenic
942264686 2:174210934-174210956 TAGAAGGATGCAAAGCTGGAGGG - Intronic
942852918 2:180511916-180511938 GAGAGGAATGCAAAAGTAAAGGG + Intergenic
944253115 2:197597929-197597951 TAAATGAATGGAAAAGTGGAAGG - Intronic
944458990 2:199924611-199924633 TAGAGAAATCCAAAGAGGGAGGG + Intronic
945296918 2:208179572-208179594 TGGAGGTATCCAAAGGTGAAGGG + Intronic
945806623 2:214498166-214498188 TAGTGCCATGCAAAGGTGGGTGG - Intronic
945990700 2:216393171-216393193 TAGAGGAATGAAAGGGTGGGAGG + Intergenic
948568877 2:238904885-238904907 TAGATGAATGGATGGGTGGAGGG + Intronic
948671327 2:239570627-239570649 GACAGGAGTGAAAAGGTGGATGG - Intergenic
949035987 2:241815972-241815994 TGGAGGAAGGCACAGGGGGACGG - Intronic
1170124738 20:12950366-12950388 GAGAGGGAAGCAAGGGTGGAGGG - Intergenic
1170453202 20:16507385-16507407 TAGATGAATGCAAAAATGTAGGG - Intronic
1172035752 20:32009974-32009996 GTGAGAAATGAAAAGGTGGATGG - Intergenic
1173857843 20:46262289-46262311 CCCAGGAAGGCAAAGGTGGAAGG + Intronic
1173951079 20:46993753-46993775 ATGAGGAATGCAAGAGTGGAGGG + Intronic
1173974902 20:47179567-47179589 TGGATGAATGGAAGGGTGGATGG + Intronic
1174302446 20:49592419-49592441 TGGATGAATACATAGGTGGATGG - Intergenic
1174306840 20:49619402-49619424 TAGATGGATGAATAGGTGGATGG + Intergenic
1174405648 20:50301366-50301388 TAGATGGATGGATAGGTGGATGG + Intergenic
1174737002 20:52973673-52973695 CAGAGGGATGCAGGGGTGGAGGG - Intronic
1175005463 20:55677625-55677647 TTAAGAAATGCAAAGGTGGGTGG - Intergenic
1175328855 20:58148894-58148916 TTGAAGAATGCAAAGGGGGCCGG - Intergenic
1175772594 20:61633010-61633032 TGGAGGAATGGAAGGGTAGATGG - Intronic
1175781020 20:61682148-61682170 TAGATGGATGGACAGGTGGATGG + Intronic
1175935116 20:62510604-62510626 TGGAGGGATGGAGAGGTGGAGGG - Intergenic
1175935121 20:62510620-62510642 TGGAGGGATGGAGAGGTGGAGGG - Intergenic
1175935129 20:62510643-62510665 TGGAGGGATGGAGAGGTGGAGGG - Intergenic
1176414230 21:6465994-6466016 TGGTGAATTGCAAAGGTGGAGGG - Intergenic
1178038232 21:28609026-28609048 TAGAGGAAGGAACAGGTGGTGGG - Intergenic
1178314076 21:31554715-31554737 GAAAGGATTGCAGAGGTGGAGGG - Intronic
1178392503 21:32210748-32210770 TAGAGGCATTAAAAGGTGGATGG + Intergenic
1178607208 21:34049341-34049363 TAGAAGAATAAAAAGATGGAAGG + Intergenic
1179017423 21:37605508-37605530 TGGATGAATGCATAGGTGGATGG - Intergenic
1179148834 21:38793348-38793370 GGGAGGAATGCAAATGTGGTAGG + Intergenic
1179262087 21:39766219-39766241 AAAAGGAAAGCAAAGATGGAAGG - Intronic
1179462423 21:41546357-41546379 TAGAAGAAAGGAAAGGAGGAAGG + Intergenic
1179609459 21:42540448-42540470 CAGAGGGATGCAAGGGCGGAAGG + Intronic
1179689728 21:43074316-43074338 TGGTGAATTGCAAAGGTGGAGGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180613749 22:17114267-17114289 GAGAGCCATGCAGAGGTGGAGGG - Exonic
1180746474 22:18092414-18092436 TGGAGGAATGCAGAGGCGGGCGG - Exonic
1181418566 22:22779723-22779745 AAGAGGAAGACAGAGGTGGAGGG + Intronic
1181877114 22:25948273-25948295 TAAATGAATGGAAAGATGGATGG - Intronic
1181900156 22:26147159-26147181 TGGATGGATGCATAGGTGGATGG + Intergenic
1182006562 22:26964968-26964990 TAGATGAATGGATGGGTGGATGG - Intergenic
1182235207 22:28869763-28869785 TAAAGTAATGCAGAGGGGGAGGG + Intergenic
1182425677 22:30270831-30270853 AAGAGGAAGGCATAGCTGGAGGG + Intergenic
1183448794 22:37878819-37878841 TAAAGGAAGGCAGAGGTGGTGGG + Intronic
1183589875 22:38773800-38773822 TAGATGAATGGATGGGTGGATGG - Intronic
1183986359 22:41572504-41572526 TAGATGAATGGATGGGTGGATGG - Intronic
1185114458 22:48923689-48923711 GAGTAGAATGGAAAGGTGGAGGG + Intergenic
1185211406 22:49572820-49572842 TAGATGGATGGAAAGATGGATGG + Intronic
949415142 3:3805938-3805960 TAGGAGAATGCATAGGTTGATGG - Intronic
949920107 3:8993627-8993649 CAGAGGAATGCCATAGTGGAGGG - Intronic
950080195 3:10216460-10216482 AAGAGGAAGGCAAAGGAGGAGGG + Intronic
950421714 3:12903457-12903479 CAGAGGAATCCCAAGCTGGAAGG - Intronic
950474361 3:13206141-13206163 TGGAGGGATGGATAGGTGGATGG - Intergenic
950815224 3:15694225-15694247 TAGAGGAATCTTAAAGTGGAAGG + Intronic
951032383 3:17896470-17896492 TAGAGGAAGGCAAAGCAAGATGG - Intronic
951658084 3:25031498-25031520 TAGAGAATTGCAGAGGTGGGTGG + Intergenic
951843573 3:27061459-27061481 AAGACCAATGTAAAGGTGGAGGG - Intergenic
952004119 3:28822597-28822619 TAGATGAATGGAAGGATGGATGG + Intergenic
952125257 3:30292248-30292270 GAGAGGAAAGGAAAGGTGAAAGG - Intergenic
952846242 3:37690233-37690255 TAGAAGAGAGCAAAGGAGGAGGG + Intronic
955342135 3:58133067-58133089 TGGAGGAATGGATGGGTGGATGG - Intronic
955342147 3:58133127-58133149 TGGAGGAATGGATGGGTGGATGG - Intronic
955711735 3:61786523-61786545 TATAGGAATTCAAGGGTGGTTGG + Intronic
956557084 3:70536063-70536085 AAGAGGAATGGAAGGATGGAAGG - Intergenic
956697429 3:71930471-71930493 TGCAGGAATGCAGAGGAGGAAGG - Intergenic
957867978 3:86049689-86049711 TAGCAGAAGGCAAAGGGGGAAGG + Intronic
957894908 3:86409766-86409788 TAGAGGTCTGTGAAGGTGGAAGG - Intergenic
958971062 3:100610715-100610737 TAAAGGAATTCAATGTTGGATGG + Intronic
960981851 3:123236431-123236453 TAGTGGGATGCAGAGGAGGATGG + Intronic
961662131 3:128474844-128474866 TGAATCAATGCAAAGGTGGAGGG - Intergenic
963059812 3:141216268-141216290 TAGATGAATGCATAGATGGGTGG + Intergenic
963060433 3:141220866-141220888 AAGAGGATGGCAAAGGGGGAAGG - Intergenic
963562724 3:146886393-146886415 AAGAGGAATAGAAAGGGGGAGGG + Intergenic
963686585 3:148442639-148442661 TAGAATATTGCAAAGGTGAAGGG - Intergenic
964219708 3:154329189-154329211 AAGTAGAATGAAAAGGTGGAAGG + Intergenic
965469323 3:169071264-169071286 CAGAGGAATGCAAGGGTTGAGGG - Intergenic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
966766576 3:183468636-183468658 TAGAGTAATGCACACATGGATGG + Intergenic
967378552 3:188832149-188832171 TAGAAGAAGGCAAAGGTGTTGGG + Intronic
967382502 3:188874735-188874757 TACAGGAATGCAGAAGTGAATGG - Exonic
967679374 3:192342405-192342427 TAGAGTGATGCAAGGTTGGAGGG + Intronic
968598636 4:1498521-1498543 TAGATGAATGGATGGGTGGATGG + Intergenic
968655833 4:1778094-1778116 AAAAGGAATGCAGAGGTGGCTGG + Intergenic
968733457 4:2283164-2283186 TAGATGAATGGATGGGTGGATGG - Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969237310 4:5874731-5874753 AAGAGGAAAGGAAAGATGGAAGG + Intronic
969424906 4:7118473-7118495 TGGAGGAATGGAAAGATGGATGG + Intergenic
969424944 4:7118657-7118679 TGGAGGAATGGAAAGATGAATGG + Intergenic
969618753 4:8268502-8268524 TCGGGGAATGGGAAGGTGGAGGG - Intergenic
970080077 4:12272980-12273002 CAAAGAAATGCAAATGTGGAAGG - Intergenic
970305932 4:14732879-14732901 TGGAGAAAAGCAAAGCTGGAAGG + Intergenic
972002447 4:34055926-34055948 TATAGCAATGCAAATGTGGACGG + Intergenic
972796094 4:42421189-42421211 TAGATGAAGAAAAAGGTGGAGGG + Intronic
972961529 4:44459059-44459081 TAGAGGAAAGAAAATGTGGCTGG + Intergenic
974486801 4:62515985-62516007 TAAAGGAATAAAAAGGAGGAAGG - Intergenic
976008816 4:80462277-80462299 TAGAGGAGTATAAAGGTAGAGGG - Intronic
976096419 4:81513081-81513103 AAGAGGAAGGGAAAGGGGGAGGG - Intronic
977568919 4:98610211-98610233 TAGTGGAATGCAAAAGATGAGGG + Intronic
977728545 4:100325276-100325298 AAGAGGAATGCAAAAGAGAAGGG - Intergenic
978725311 4:111962658-111962680 TAGAGGAATAACAAGGTGGAGGG - Intergenic
979307197 4:119160226-119160248 AAGAAGGATGTAAAGGTGGATGG - Intronic
979396482 4:120195901-120195923 TTGAGGGATGCATAGGTGGCTGG + Intergenic
981360786 4:143843349-143843371 TAGAGGAAGGGAAAGGAAGAGGG + Intergenic
981360794 4:143843381-143843403 TAGAGGAAGGGAAAGGAAGAGGG + Intergenic
981860556 4:149350961-149350983 TAGAGGGATGGATAGATGGATGG + Intergenic
983301295 4:165929293-165929315 TAGAGGGAGGCCAAGGTGGGCGG + Intronic
984486683 4:180379100-180379122 TAGAGGAATTCAAAAGAGGAAGG - Intergenic
985837297 5:2280712-2280734 TAGATGAGTGGACAGGTGGATGG + Intergenic
985837348 5:2280911-2280933 TAGATGAATGGGCAGGTGGATGG + Intergenic
986160728 5:5226045-5226067 TAGAGAGATGCGAAGATGGAAGG - Intronic
988844294 5:35113337-35113359 TAGATGGATGGAAAGGTGGGTGG - Intronic
988980568 5:36564060-36564082 AAGAGTAATGAAGAGGTGGATGG + Intergenic
989312448 5:40035911-40035933 TACAGGAAAGAAAAGGTAGAGGG + Intergenic
991461159 5:66860827-66860849 TAGTGGCATGCAAAGTAGGAAGG - Intronic
991966883 5:72101565-72101587 AAGAGGAATGCTAAGGTATATGG + Intergenic
993536473 5:89092777-89092799 TAGAGGAATACACAGGAGCATGG + Intergenic
995042949 5:107609766-107609788 TGGAGGAGGGCTAAGGTGGAAGG - Intronic
996915616 5:128708635-128708657 TAGACAAATGCAAAAATGGAGGG + Intronic
999287514 5:150402945-150402967 AATAGGAATGCACAGGTGGGTGG + Intronic
999616388 5:153429185-153429207 TAGAAGTATGCAGAGGTGGATGG + Intergenic
1000234190 5:159342397-159342419 TGGAGGAATGGAAAGGAGGTTGG + Intergenic
1000325154 5:160166440-160166462 TAGAGGAAGGAAAAGGGAGAAGG - Intergenic
1000729745 5:164818809-164818831 TAGAGGGATGCAACTGTGTAAGG - Intergenic
1000932189 5:167265029-167265051 TAAAGGAAAGGAAAGGTGGCCGG + Intergenic
1001037852 5:168310727-168310749 TTGTGGAATGCTGAGGTGGAAGG + Intronic
1001249374 5:170134816-170134838 TATAGCAATGCAAAGAAGGATGG + Intergenic
1001413327 5:171525986-171526008 TAGAAGAATGGATAGATGGATGG - Intergenic
1001569101 5:172718541-172718563 TAGATGAATGGATGGGTGGATGG + Intergenic
1001768538 5:174274569-174274591 TAGATGAGTGCAAGGATGGATGG - Intergenic
1002166889 5:177353331-177353353 AAGAGGAAGGCATTGGTGGAGGG - Intergenic
1002834855 6:857487-857509 TGGAGGAATGGATAGGTGGATGG - Intergenic
1004697236 6:18044854-18044876 AAGAGAAAGGCAAAGGTTGATGG + Intergenic
1005315166 6:24596987-24597009 TAGAAGAATAGAAAGATGGATGG - Intronic
1005655048 6:27927593-27927615 TAGTGGAATGGAAAGGCTGAGGG - Intergenic
1007638375 6:43315342-43315364 TAGAAGACTGGAAAAGTGGAGGG - Intronic
1009371019 6:62904200-62904222 TAGAGACATGCAAAATTGGATGG - Intergenic
1009473200 6:64054469-64054491 TAGAGGAGGATAAAGGTGGAAGG + Intronic
1011117157 6:83906087-83906109 CAGTGGAATGCTCAGGTGGAGGG + Intronic
1011551547 6:88535281-88535303 TAGAGGAATGCTCAGGAGAAGGG + Intergenic
1013016543 6:106165019-106165041 TAGAAGAATAGAAAGGGGGATGG + Intergenic
1013616835 6:111851163-111851185 TAGAGGACAGCAGAGGTGGCTGG + Intronic
1014485523 6:121994315-121994337 TAGGGGAATGGATGGGTGGAGGG + Intergenic
1014503147 6:122218655-122218677 TAGGGGAAGGCACAGGTAGAGGG + Intergenic
1014622433 6:123685137-123685159 TAGAGGGATAGAAAGGTTGATGG + Intergenic
1015485864 6:133768812-133768834 TAGAGGAATGCAGAGGTACCTGG + Intergenic
1016051418 6:139534326-139534348 CAGAGCCATGCAAAGCTGGAAGG + Intergenic
1016235390 6:141857643-141857665 TGGAGGGATGCAAATGTGGAGGG + Intergenic
1016739885 6:147515552-147515574 TAGATGAATGGAGAGATGGATGG - Intronic
1017274557 6:152551079-152551101 TAGAGGAAGGAAAAGGTGTCAGG - Intronic
1017321131 6:153094476-153094498 TAGAGAAAAGCAAAGGTACAAGG - Intronic
1019710253 7:2515142-2515164 TGGATGGATGGAAAGGTGGATGG - Intronic
1019914627 7:4124877-4124899 TAGATGAATGGATGGGTGGATGG + Intronic
1019990711 7:4688773-4688795 TACAGGAATGACAAGGGGGAGGG - Intronic
1021073992 7:16277936-16277958 AAAAGGAATGAAAAGGGGGATGG + Intronic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1023603656 7:41906795-41906817 AAGAGGCATGCCAAGATGGAGGG - Intergenic
1023938067 7:44753932-44753954 GAGAGCAATTCAAAGGAGGAAGG - Intronic
1024338189 7:48230795-48230817 TAGATGAATGGGGAGGTGGATGG - Intronic
1026250119 7:68662664-68662686 TAGAGGAATGATAGGGAGGAAGG + Intergenic
1027975039 7:85142650-85142672 TAGAAGAAAGCAAAGAAGGATGG + Intronic
1028303700 7:89234512-89234534 TAGAGGGATGCCAAGATGGCTGG + Intronic
1028944746 7:96564634-96564656 TAGAGGAACCAAAAGGTGGAAGG + Intronic
1029083077 7:97990036-97990058 TCCAGGAATGCCAAGGTAGAGGG - Exonic
1029954630 7:104624658-104624680 TAGAGAGATGGATAGGTGGATGG + Intronic
1030626783 7:111853624-111853646 CAGAGGAAAGCAACAGTGGAGGG + Intronic
1030675049 7:112375759-112375781 TAGACGAATGGACAGATGGATGG - Intergenic
1031036890 7:116797302-116797324 TAGAGCAAAGAAAGGGTGGATGG + Intronic
1031318477 7:120289003-120289025 GAGAGGAAGGCAGAGGTGGGAGG + Intronic
1031920510 7:127596867-127596889 GAGAGGGAGGCAAGGGTGGAGGG - Intronic
1032022492 7:128416746-128416768 TAGAGGAGTGCAAAGAATGAGGG + Intergenic
1032739281 7:134722767-134722789 TAGCAGAAAGGAAAGGTGGAGGG - Intergenic
1032867306 7:135939384-135939406 TAGAGGAAAGCAAAGAAGAACGG - Intronic
1034270474 7:149801203-149801225 TAGATGAATCCATGGGTGGATGG - Intergenic
1035058473 7:156052106-156052128 TGGAGGAATGGATGGGTGGATGG - Intergenic
1035877215 8:3203976-3203998 TACAGGGATGCAAAGATGAAAGG - Intronic
1035948521 8:3992670-3992692 ACAAGGAATGCTAAGGTGGAAGG + Intronic
1035961280 8:4140760-4140782 TAGGGGAGAGCAAAGCTGGAGGG - Intronic
1036622607 8:10434801-10434823 GACAGGAATGAACAGGTGGATGG - Intergenic
1036688514 8:10927001-10927023 AAGGGGAAAGCAAAGGTGAAGGG + Intronic
1038153641 8:24965992-24966014 CAGAGCTATCCAAAGGTGGAAGG + Intergenic
1038575088 8:28698275-28698297 TTGAGGAGTGCAAAGTGGGAAGG + Intronic
1038616876 8:29103702-29103724 TAGAGGAATGGAAAGCAGGCTGG + Intronic
1039947861 8:42145484-42145506 TAGAGGAAGACAAAGATGGGGGG + Intergenic
1042228524 8:66534182-66534204 CAGAGGCATGCACAGGGGGAAGG + Intergenic
1045772567 8:105760339-105760361 TAAAAGAATGCAAAGCTGCATGG + Intronic
1046629887 8:116612972-116612994 TAGTGGAGTGGAAAGGTGAATGG - Intergenic
1047911174 8:129531330-129531352 TTGAGGAATCCAAAAGTTGAAGG + Intergenic
1048191343 8:132292582-132292604 CAGAGGAATGAATGGGTGGATGG + Intronic
1048296997 8:133221758-133221780 TAGATGAGTGGACAGGTGGATGG + Intronic
1048366366 8:133742334-133742356 TAGAAGAATGGAAAGAAGGAAGG + Intergenic
1048879328 8:138859789-138859811 TGCAGGGATGCAAAGGTGGGAGG - Intronic
1049364201 8:142228832-142228854 TAGATGAATGGATGGGTGGAAGG + Intronic
1049464170 8:142743626-142743648 TAGATGGATGGATAGGTGGATGG + Intergenic
1052744425 9:32426236-32426258 TAGAGGAAAGCAAAGGAAGCTGG + Intronic
1054803836 9:69379374-69379396 GAGATGACTGCAAAGCTGGAGGG + Intronic
1055043596 9:71901700-71901722 GAGAGGAATGAAGAGGGGGATGG - Intronic
1055235576 9:74118786-74118808 TAGAGGAAAGGAAAGTAGGAAGG + Intergenic
1055505444 9:76943644-76943666 TAGAGGAATGAGAGGGTGAATGG - Intergenic
1056682316 9:88730507-88730529 TGGATGAATGAACAGGTGGATGG - Intergenic
1056682326 9:88730551-88730573 TAGATGCATGGATAGGTGGAAGG - Intergenic
1056682356 9:88730705-88730727 TGGATGAATGGACAGGTGGATGG - Intergenic
1056682419 9:88730993-88731015 TGGATGAATGGACAGGTGGATGG - Intergenic
1056900718 9:90597004-90597026 TAGAGGAATGGGAAGGGAGAGGG - Intergenic
1057273145 9:93661910-93661932 TAGATGAATGAAAAAATGGATGG + Intronic
1057273184 9:93662156-93662178 CAGAGGAATGAATAGATGGATGG + Intronic
1057722608 9:97545101-97545123 TAGAGGAATACATGGGTGGCTGG - Intronic
1058662012 9:107275198-107275220 TAGAGGAAGGCAAGGATGGATGG - Intergenic
1059112164 9:111567762-111567784 TATAGGGATGCAAAGATGGGAGG + Intronic
1059903042 9:118950239-118950261 GAGAGAAATGGAAAGGAGGAAGG + Intergenic
1059953921 9:119496405-119496427 TGGATGAATGCAAGGATGGATGG - Intronic
1061025235 9:128044158-128044180 TAGAAAAATGGAAAGGTGGCTGG + Intergenic
1061285269 9:129619224-129619246 GAGATGGATGCAAAGATGGATGG + Intronic
1061361263 9:130143806-130143828 GAGATGGCTGCAAAGGTGGAGGG - Intergenic
1061398700 9:130356971-130356993 TGGATGGATGGAAAGGTGGAGGG + Intronic
1061398727 9:130357087-130357109 TGGATGGATGGAAAGGTGGATGG + Intronic
1061963180 9:133998500-133998522 TGGAGGAATGGATTGGTGGAAGG - Intergenic
1061963206 9:133998588-133998610 TGGAGGAATGGATTGGTGGAAGG - Intergenic
1061963232 9:133998676-133998698 TGGAGGAATGGATTGGTGGAAGG - Intergenic
1061963258 9:133998764-133998786 TGGAGGAATGGATTGGTGGAAGG - Intergenic
1061963284 9:133998852-133998874 TGGAGGAATGGATTGGTGGAAGG - Intergenic
1062148532 9:135004952-135004974 TAGATGAATGAATGGGTGGATGG + Intergenic
1062247720 9:135578025-135578047 TAGATGAATGAATAGATGGAAGG - Intergenic
1062247858 9:135578717-135578739 TAGATGAATGAATAGATGGAAGG - Intergenic
1062271128 9:135709581-135709603 TAGAGAGATGCAGAGTTGGACGG - Intronic
1185497591 X:566901-566923 TGGATGAATGAACAGGTGGATGG + Intergenic
1185580897 X:1211018-1211040 TGGGTGAATGCATAGGTGGATGG + Intronic
1185710989 X:2303721-2303743 TAGATGGATGGATAGGTGGATGG + Intronic
1186002069 X:5023804-5023826 TAGATGAATGGATGGGTGGATGG - Intergenic
1186168711 X:6854820-6854842 CAGAGGGGTGCAGAGGTGGAAGG + Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186481906 X:9902348-9902370 TGGAGGCATGGGAAGGTGGATGG + Intronic
1186974342 X:14884478-14884500 TGGAGGAATGAAAAGGGGAATGG + Intronic
1187389930 X:18879221-18879243 AAGAGGAATTCACAGGTGGCAGG - Intergenic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1190084620 X:47384381-47384403 TGGAGGAATGTAAGGGTTGATGG + Intronic
1190245231 X:48686387-48686409 TAAATGAATGAAAAGGTAGATGG + Intronic
1190255960 X:48762285-48762307 TAGAGGAGGCCAAAGGAGGAAGG + Intronic
1190594723 X:52041463-52041485 TAGCGGAAGGCAAAGGAAGAAGG - Intergenic
1190614101 X:52212610-52212632 TAGCGGAAGGCAAAGGAAGAAGG + Intergenic
1191691453 X:63943337-63943359 TAGAGGGATGTAAAAGTGTATGG - Intergenic
1191921130 X:66258259-66258281 TGGAGGAGTTCACAGGTGGAAGG + Intronic
1192656447 X:72999816-72999838 TAGAGGAAGGAAAGGGAGGAAGG - Intergenic
1192665673 X:73083185-73083207 TAGAGGAAGGAAAGGGAGGAAGG + Intergenic
1193586851 X:83333116-83333138 TAGAAGAATGCAAAACTTGAAGG - Intergenic
1194862524 X:99019428-99019450 GATAGGAGTTCAAAGGTGGATGG - Intergenic
1194919990 X:99753106-99753128 TACAGGAATAAAAACGTGGAAGG + Intergenic
1194921444 X:99771362-99771384 TAGAGGAAGGCAGAGAGGGAGGG + Intergenic
1197106081 X:122717824-122717846 TTGAAAAATGCAGAGGTGGATGG + Intergenic
1197816262 X:130501747-130501769 TAGAGAAATGGAAAGAAGGAAGG - Intergenic
1198244093 X:134812635-134812657 TAGGGGAATTCAAAGAAGGAAGG + Intronic
1199672123 X:150156055-150156077 TGGAGCAATCCAATGGTGGATGG - Intergenic
1200031618 X:153301517-153301539 TAGAGGCTGGGAAAGGTGGAGGG + Intergenic
1200310005 X:155068545-155068567 CAGAGAAATGCAAAGGCTGAGGG + Intronic
1201305911 Y:12550401-12550423 TGGAGGCATGGGAAGGTGGATGG + Intergenic