ID: 1168140232

View in Genome Browser
Species Human (GRCh38)
Location 19:54381025-54381047
Sequence GTCACGAAGGGGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168140232_1168140238 -5 Left 1168140232 19:54381025-54381047 CCTCCCACTTTCCCCTTCGTGAC No data
Right 1168140238 19:54381043-54381065 GTGACCCTGATCCAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168140232 Original CRISPR GTCACGAAGGGGAAAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr