ID: 1168141230

View in Genome Browser
Species Human (GRCh38)
Location 19:54388667-54388689
Sequence AGGGGGAGAAACTTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168141230_1168141241 21 Left 1168141230 19:54388667-54388689 CCCTCCTCCAAGTTTCTCCCCCT No data
Right 1168141241 19:54388711-54388733 CCCGTGTCTCTGTGCCGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168141230 Original CRISPR AGGGGGAGAAACTTGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr