ID: 1168141241

View in Genome Browser
Species Human (GRCh38)
Location 19:54388711-54388733
Sequence CCCGTGTCTCTGTGCCGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168141238_1168141241 -5 Left 1168141238 19:54388693-54388715 CCAGCCTTCACGTTCAGTCCCGT No data
Right 1168141241 19:54388711-54388733 CCCGTGTCTCTGTGCCGTACAGG No data
1168141230_1168141241 21 Left 1168141230 19:54388667-54388689 CCCTCCTCCAAGTTTCTCCCCCT No data
Right 1168141241 19:54388711-54388733 CCCGTGTCTCTGTGCCGTACAGG No data
1168141231_1168141241 20 Left 1168141231 19:54388668-54388690 CCTCCTCCAAGTTTCTCCCCCTT No data
Right 1168141241 19:54388711-54388733 CCCGTGTCTCTGTGCCGTACAGG No data
1168141234_1168141241 4 Left 1168141234 19:54388684-54388706 CCCCCTTCTCCAGCCTTCACGTT No data
Right 1168141241 19:54388711-54388733 CCCGTGTCTCTGTGCCGTACAGG No data
1168141237_1168141241 1 Left 1168141237 19:54388687-54388709 CCTTCTCCAGCCTTCACGTTCAG No data
Right 1168141241 19:54388711-54388733 CCCGTGTCTCTGTGCCGTACAGG No data
1168141233_1168141241 14 Left 1168141233 19:54388674-54388696 CCAAGTTTCTCCCCCTTCTCCAG No data
Right 1168141241 19:54388711-54388733 CCCGTGTCTCTGTGCCGTACAGG No data
1168141232_1168141241 17 Left 1168141232 19:54388671-54388693 CCTCCAAGTTTCTCCCCCTTCTC No data
Right 1168141241 19:54388711-54388733 CCCGTGTCTCTGTGCCGTACAGG No data
1168141235_1168141241 3 Left 1168141235 19:54388685-54388707 CCCCTTCTCCAGCCTTCACGTTC No data
Right 1168141241 19:54388711-54388733 CCCGTGTCTCTGTGCCGTACAGG No data
1168141236_1168141241 2 Left 1168141236 19:54388686-54388708 CCCTTCTCCAGCCTTCACGTTCA No data
Right 1168141241 19:54388711-54388733 CCCGTGTCTCTGTGCCGTACAGG No data
1168141239_1168141241 -9 Left 1168141239 19:54388697-54388719 CCTTCACGTTCAGTCCCGTGTCT No data
Right 1168141241 19:54388711-54388733 CCCGTGTCTCTGTGCCGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168141241 Original CRISPR CCCGTGTCTCTGTGCCGTAC AGG Intergenic
No off target data available for this crispr