ID: 1168142880

View in Genome Browser
Species Human (GRCh38)
Location 19:54401017-54401039
Sequence TTCCTCTGTGGAGGGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168142880_1168142889 16 Left 1168142880 19:54401017-54401039 CCACCTTTCCCTCCACAGAGGAA No data
Right 1168142889 19:54401056-54401078 CCACTAAGACTCAGACTGACAGG No data
1168142880_1168142890 17 Left 1168142880 19:54401017-54401039 CCACCTTTCCCTCCACAGAGGAA No data
Right 1168142890 19:54401057-54401079 CACTAAGACTCAGACTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168142880 Original CRISPR TTCCTCTGTGGAGGGAAAGG TGG (reversed) Intergenic