ID: 1168145772

View in Genome Browser
Species Human (GRCh38)
Location 19:54419370-54419392
Sequence TGTCCCCGGAGGACACCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168145772_1168145779 1 Left 1168145772 19:54419370-54419392 CCTGGGGGTGTCCTCCGGGGACA 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1168145779 19:54419394-54419416 GGAGGAAGCAGACAGGAAGGAGG 0: 1
1: 0
2: 20
3: 188
4: 1713
1168145772_1168145778 -2 Left 1168145772 19:54419370-54419392 CCTGGGGGTGTCCTCCGGGGACA 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1168145778 19:54419391-54419413 CATGGAGGAAGCAGACAGGAAGG 0: 1
1: 0
2: 8
3: 66
4: 597
1168145772_1168145777 -6 Left 1168145772 19:54419370-54419392 CCTGGGGGTGTCCTCCGGGGACA 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1168145777 19:54419387-54419409 GGGACATGGAGGAAGCAGACAGG 0: 1
1: 0
2: 4
3: 44
4: 557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168145772 Original CRISPR TGTCCCCGGAGGACACCCCC AGG (reversed) Intronic
900430952 1:2603051-2603073 TGTCCCCGCAGGCCAGCCCTGGG + Intronic
901669888 1:10849983-10850005 TGCCCCAGCAGGACACCCCAGGG + Intergenic
902399659 1:16150992-16151014 TGACTCCTGAAGACACCCCCAGG - Intronic
903137406 1:21318450-21318472 TCTCCAGGGAGGACACCCCTAGG - Intronic
903967328 1:27099038-27099060 TGTCCCTGGGGCACTCCCCCAGG - Exonic
904893749 1:33798790-33798812 GGACCCTGGAGGACACCCACTGG + Intronic
905121328 1:35684306-35684328 TGTCCTCTGAGGTCACACCCAGG + Intergenic
906528894 1:46512078-46512100 GGGCCCAGGAGGCCACCCCCTGG - Exonic
909490234 1:76218275-76218297 TGGCCCCGGAGGCCACCTTCAGG + Intronic
914913155 1:151802524-151802546 TGTACCTGGAGGACTCCCACTGG - Exonic
915734945 1:158078665-158078687 TGTTCCTGGAGGAGGCCCCCAGG - Intronic
924624820 1:245689024-245689046 TGTCCCCGGCGGAGCCCCGCGGG - Intronic
1063100256 10:2944353-2944375 TGTCCCCGCCGGACACCACCAGG - Intergenic
1064347036 10:14541558-14541580 TGTCTCCGGAGGAGAGGCCCCGG - Intronic
1065101636 10:22336721-22336743 TGTCACCGAAGGCAACCCCCAGG - Intergenic
1065116794 10:22490957-22490979 TGTCCCAGTAGGACATCCCATGG + Intergenic
1067778074 10:49177212-49177234 AGTCCCCAGAGGAAACCACCAGG + Intronic
1073086008 10:100889539-100889561 TGTTCCCGGAGAAAACTCCCAGG + Intergenic
1074229337 10:111517875-111517897 GGTGCTCAGAGGACACCCCCAGG + Intergenic
1075444585 10:122504648-122504670 TGTCCCTGGTGGACCTCCCCTGG + Intronic
1075634980 10:124024385-124024407 TGTCCACAGAGGACACCTCTTGG + Intronic
1076912994 10:133401707-133401729 TGTCCCCGCTGAGCACCCCCGGG + Intronic
1077096116 11:799840-799862 CCTCCCGGTAGGACACCCCCAGG + Exonic
1077176809 11:1194857-1194879 TGTCCCCCGAGAACAACCCTGGG - Intronic
1079327573 11:19507339-19507361 TGTCCCAGGAGGACTCTCCAGGG - Intronic
1083405845 11:62456564-62456586 TGACCCTGGTGGACACTCCCTGG + Intronic
1083681092 11:64352215-64352237 AGTCCCAGGAGGAGACCCGCGGG + Exonic
1083747197 11:64743048-64743070 TGTCCCCCGCGGCCACTCCCGGG + Intronic
1083888720 11:65585270-65585292 CGTTCCTGGAGGCCACCCCCGGG - Exonic
1084196079 11:67524126-67524148 GGGCCCCGGAGGACAGACCCAGG - Intergenic
1084408421 11:68992150-68992172 TGGCCCCAGAGGACCCCTCCCGG + Intergenic
1088604216 11:111512806-111512828 CGGCCCCCGAGGACACCCCCGGG - Intergenic
1088754895 11:112877760-112877782 TGTCCCCGGCAGCCAGCCCCAGG + Intergenic
1089659751 11:119978211-119978233 AGTCCCGGGAGGAGAGCCCCTGG + Intergenic
1096487645 12:51994485-51994507 GGTCCCCGAAGGAAACCCTCAGG - Intronic
1096522426 12:52191828-52191850 TGACCCCGGTGGGCAGCCCCCGG - Exonic
1096614270 12:52822935-52822957 TGACCCCGGAGCAGACTCCCTGG + Intronic
1104870392 12:131991135-131991157 TTGCCTCTGAGGACACCCCCAGG + Intronic
1105987817 13:25586453-25586475 TGTCCCTGGAGCACACGCCTGGG - Intronic
1107017517 13:35719591-35719613 TGTCCATGGAGGCCCCCCCCGGG - Intergenic
1107328869 13:39275128-39275150 TGTCTCTGGAGGACTTCCCCTGG - Intergenic
1110119441 13:71865263-71865285 AGTCCCCGGAGCCCATCCCCCGG + Intronic
1110286090 13:73751920-73751942 TGTACCCTGAGGACACACACAGG + Intronic
1118388869 14:65280091-65280113 TGTCCCCGGAGGGCAGGTCCGGG - Intergenic
1121320386 14:92988498-92988520 GGACCCCAGAGGGCACCCCCAGG + Intronic
1121424906 14:93843455-93843477 TGTGCCCTGAGGACAGCCCTGGG + Intergenic
1122370898 14:101228487-101228509 TGTCCCTGGAGGAGCCCCCAGGG + Intergenic
1122406770 14:101505461-101505483 TGTCCGTGGGGGCCACCCCCGGG - Intergenic
1202832987 14_GL000009v2_random:57374-57396 TGTGCCCGGAGGTCAGGCCCTGG - Intergenic
1124594914 15:31084088-31084110 TGTCCCCAGAGGAGAGCCCCTGG - Intronic
1125464228 15:39934554-39934576 TTTCCCCAGAGGAATCCCCCTGG + Intronic
1130310553 15:82750265-82750287 ATTCCCCGGAGGACATCCGCGGG + Intergenic
1130648954 15:85751428-85751450 TGGCCCGGGGGGACACCCACAGG - Intergenic
1131067700 15:89444564-89444586 TGTCCCGGGAGGCCTCCTCCTGG - Intergenic
1133297198 16:4760375-4760397 TGTCCACGGAGGATCGCCCCAGG + Intronic
1140442768 16:74999716-74999738 TGTCATCGGTGGAGACCCCCGGG - Exonic
1140457823 16:75115022-75115044 CGTCCCCGGACCACACCCCGCGG + Intronic
1142174899 16:88640648-88640670 TCTCCCCTGAGGACACCCCTGGG + Intergenic
1142303770 16:89274377-89274399 TGTCCCCGTATGACAGCCCCTGG + Intronic
1142379141 16:89721796-89721818 CGTCCCCGCAGGACCCCACCGGG - Exonic
1142483035 17:230091-230113 AGGCCCCCGAGGACAGCCCCAGG + Intronic
1142631415 17:1228929-1228951 TCGCCGCGGAGGAGACCCCCGGG - Intronic
1145990839 17:29078585-29078607 TGTCCCCCGAGTGCAGCCCCTGG - Exonic
1152847807 17:82613375-82613397 TGTCCCCGCAAGACATCCCAGGG + Intronic
1155152586 18:23135095-23135117 TCTCCCAGGAGCACAGCCCCAGG + Intronic
1157258298 18:46157513-46157535 TGTCCCAGGAGGGAAACCCCGGG + Intergenic
1160604735 18:80041474-80041496 TGTGCCCAGTGGACACGCCCTGG - Intronic
1161264749 19:3359108-3359130 TGTGCCCGGCGGACACCCACGGG + Intergenic
1162799468 19:13102896-13102918 TGACCCCGGAGGAAACCAGCGGG + Intronic
1163390252 19:17026531-17026553 TGTCGCCGGAGGATACTCACGGG + Exonic
1166350684 19:42196640-42196662 TGAGCCCGGAGGACAACCCTGGG - Intergenic
1168145772 19:54419370-54419392 TGTCCCCGGAGGACACCCCCAGG - Intronic
927932670 2:27055225-27055247 TGTCCCCGGACCACACCATCGGG - Exonic
931271442 2:60707231-60707253 TGTGGCTGGAGGACACCCCAAGG - Intergenic
934553789 2:95277096-95277118 CGCCCCAGGAGGACACCCGCTGG - Intronic
947869984 2:233429669-233429691 TCCCTCCAGAGGACACCCCCCGG - Intronic
948802491 2:240439235-240439257 GCTTCTCGGAGGACACCCCCAGG + Intronic
948860641 2:240751092-240751114 GGAGCCCTGAGGACACCCCCAGG + Intronic
1169205848 20:3740028-3740050 TAGCCCTGGAGGACAGCCCCAGG - Intronic
1171122957 20:22581867-22581889 TGGGCCGGGAGTACACCCCCTGG + Exonic
1171307324 20:24117564-24117586 TGCCCCTGGAGGAAACCCCAGGG + Intergenic
1171523678 20:25794053-25794075 TGTCCCAGGGTGAAACCCCCAGG + Intronic
1171532188 20:25860181-25860203 TGTCCCAGGACCAAACCCCCAGG + Intronic
1171553149 20:26061830-26061852 TGTCCCAGGGTGAAACCCCCAGG - Intergenic
1171855032 20:30335949-30335971 TGTCCCCGGGCCAAACCCCCAGG + Intergenic
1174346885 20:49936664-49936686 GAGCCCCGGGGGACACCCCCGGG - Intronic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1176048324 20:63103837-63103859 GCTCCCAGGAAGACACCCCCAGG + Intergenic
1176548996 21:8213504-8213526 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1176567925 21:8396534-8396556 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1176575829 21:8440753-8440775 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1180168063 21:46040334-46040356 TGTTCACAGAGGACACCCCAAGG - Intergenic
1181085973 22:20439486-20439508 TGTCCAGGGAGGGCACCACCTGG + Intronic
1181540926 22:23572978-23573000 TTTCCCCAGGGGACACCCCTGGG + Intergenic
1181550837 22:23638340-23638362 TTTCCCCAGGGGACACCCCTGGG + Intergenic
1181989919 22:26829584-26829606 TGTCCCCAGCCGACTCCCCCAGG + Intergenic
1182080733 22:27526955-27526977 TGTCCACGGAAAACACCCCCGGG + Intergenic
1182103669 22:27674131-27674153 TGTCCCCGGGGGGCCTCCCCCGG - Intergenic
1184568861 22:45309846-45309868 GGTCCCCGGAGGCCCCGCCCCGG - Intronic
1185021243 22:48377500-48377522 GGTCCCGGGAGGACCCCCCATGG - Intergenic
1185342556 22:50298186-50298208 TGTCCCCGCAGGTCACCCCCAGG + Intronic
1203253880 22_KI270733v1_random:129811-129833 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1203261936 22_KI270733v1_random:174890-174912 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
949414151 3:3798925-3798947 GGTCTGCGGAGGACGCCCCCGGG + Intronic
949546824 3:5079989-5080011 ACTCCCTGGAGGACCCCCCCAGG + Intergenic
950533203 3:13565088-13565110 TGTCCCTGCTGGACACTCCCTGG + Intronic
950822424 3:15775387-15775409 ATTCCCCGGAGGACACCAGCTGG + Intronic
953223794 3:40998407-40998429 TGTGGCCGGAGAACGCCCCCAGG - Intergenic
953753422 3:45627051-45627073 TGTCCCCGAAGGAGAGGCCCTGG + Intronic
953885618 3:46712916-46712938 TGTGTGCGGAGGACACCCACAGG - Exonic
961514133 3:127422526-127422548 TGTCCCTCTGGGACACCCCCTGG - Intergenic
965080320 3:164024387-164024409 TTCCCCCGGAGGAACCCCCCTGG - Intergenic
965350201 3:167602197-167602219 TGGCCCCAAAGGACACCCACTGG + Exonic
966154585 3:176902291-176902313 TGTCCCTGGACGACACCACAGGG + Intergenic
967896152 3:194397418-194397440 TCTCCCCGAAGAGCACCCCCGGG + Exonic
968615669 4:1576767-1576789 TGGCCCCTGGGGACAGCCCCAGG + Intergenic
968902754 4:3439092-3439114 GGGCCCCTGAGGACGCCCCCAGG + Intronic
968941812 4:3642987-3643009 TGTCCCAGCAGGAGACCACCCGG - Intergenic
972249191 4:37281251-37281273 TGTCACACGAGGACACCCACTGG - Intronic
972654409 4:41050957-41050979 TGAGCCCGGAGGCCACCACCAGG + Intronic
992719293 5:79544284-79544306 TGTCCCAGGAAGAAATCCCCAGG + Intergenic
997272941 5:132557052-132557074 CGTCCCCGGCGGGCAGCCCCAGG + Exonic
998108266 5:139482058-139482080 TGTCCCCGGAACCCACCCCAGGG + Intronic
1001732821 5:173972903-173972925 GGTCCCCTGAGGACACCTCGGGG - Intergenic
1001923347 5:175617703-175617725 TTTCCCTGGAGGACTGCCCCGGG - Intergenic
1003493315 6:6642330-6642352 AGTCCCGGGAGGACCCCTCCAGG + Intronic
1004662819 6:17725365-17725387 AGTCCCCAGAGCACGCCCCCAGG - Intergenic
1005209400 6:23443238-23443260 TGACAACGGAGGACACCACCTGG - Intergenic
1007473321 6:42104531-42104553 TGTCCCTGGAGGGCGCCGCCCGG - Exonic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1013478097 6:110528210-110528232 TGTGCTCCGAGGACACGCCCTGG - Intergenic
1017969497 6:159299440-159299462 TGTCCCCACAGGACAGCACCAGG + Intergenic
1019276541 7:178793-178815 TGCCCCCGCAAGACACCTCCTGG - Intergenic
1019919069 7:4151269-4151291 TGGCCCCAGAGGACCCACCCTGG + Intronic
1020436041 7:8163615-8163637 TGTCCTCGGAGGACATCCTCTGG - Intronic
1029116663 7:98241173-98241195 GGTCCCTGCTGGACACCCCCGGG - Exonic
1029680452 7:102105096-102105118 TGTCCCCAGAGGACACACACTGG - Intronic
1031688727 7:124764261-124764283 TTTCCCCGGCGGGGACCCCCAGG + Exonic
1035613953 8:988759-988781 GGTCCCCGGGGGACAGGCCCTGG - Intergenic
1040388907 8:46933239-46933261 TGTCCCAGGAAGAGTCCCCCTGG + Intergenic
1048443809 8:134478610-134478632 CGTCGTCGGAGGACACCACCAGG + Exonic
1049338803 8:142100881-142100903 TCTGCCCCGAGGACACCCTCTGG - Intergenic
1053163504 9:35829348-35829370 GGACACCGGAGGCCACCCCCCGG + Intronic
1053455902 9:38233035-38233057 TGTCCCTGCAGGACATACCCAGG + Intergenic
1055728629 9:79258162-79258184 TGTCCACGCAGCACAGCCCCAGG - Intergenic
1056664223 9:88568384-88568406 TGGCCAGGGACGACACCCCCGGG - Intronic
1056781192 9:89552610-89552632 TGTCCACGGAGAAGACCGCCTGG - Intergenic
1061242450 9:129382514-129382536 TGCCTCCAGGGGACACCCCCTGG + Intergenic
1062297694 9:135841613-135841635 TGTCCCAGAAGGGCACCCTCCGG - Intronic
1203470280 Un_GL000220v1:112955-112977 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1203478101 Un_GL000220v1:156927-156949 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1186493471 X:9993107-9993129 TGTCCCGGCAGGAAACCCCCCGG - Intergenic
1189134123 X:38531784-38531806 TCTCCCTGGAGGACTCCCCAGGG + Intronic
1189179756 X:38992504-38992526 TCTCCTCAGAGGACACCCCCCGG + Intergenic