ID: 1168147141

View in Genome Browser
Species Human (GRCh38)
Location 19:54426158-54426180
Sequence TGCTCCCCACGTTACATGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168147137_1168147141 13 Left 1168147137 19:54426122-54426144 CCCACTCGAGGCAATATTCTCAA 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1168147141 19:54426158-54426180 TGCTCCCCACGTTACATGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 91
1168147138_1168147141 12 Left 1168147138 19:54426123-54426145 CCACTCGAGGCAATATTCTCAAG No data
Right 1168147141 19:54426158-54426180 TGCTCCCCACGTTACATGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168147141 Original CRISPR TGCTCCCCACGTTACATGTA GGG Intronic
900921738 1:5676574-5676596 TGCTTCACACGTTACAAGTCTGG + Intergenic
905357966 1:37398058-37398080 TGAGCCCCATGTTACATGGAAGG - Intergenic
907959851 1:59268656-59268678 TTCTCCCCACTTTACAGATAAGG - Intergenic
913697669 1:121343470-121343492 TCCTACCCAGGTTAGATGTAAGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
916098572 1:161373486-161373508 TTATCCCCATTTTACATGTAAGG - Exonic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
923022249 1:230174245-230174267 TGCTCCCCACGTGTCATGCGGGG + Intronic
924678554 1:246205911-246205933 TGATCCCCACTTTACATATGAGG - Intronic
1065364219 10:24919003-24919025 TTATCCCCATTTTACATGTAAGG - Intronic
1065425676 10:25600753-25600775 TGCTCGACATGTAACATGTAAGG + Exonic
1066363956 10:34758326-34758348 TGCTCCCCATTTTACAGATAAGG + Intronic
1066601047 10:37107470-37107492 TGCTCAGCACCTGACATGTAAGG - Intergenic
1067548323 10:47213533-47213555 TAATCCCCACGTTTCATGTGAGG + Intergenic
1071462818 10:85914537-85914559 TGCACCCCACGGTAAATGGACGG + Intronic
1071716661 10:88103873-88103895 TGCTCCCCAGGGTTCATGTGAGG + Intergenic
1072618522 10:97065104-97065126 TGCTCCCCAGGGGATATGTAAGG - Intronic
1075282474 10:121151756-121151778 TTCTCCCCATGATACATGCATGG + Intergenic
1077524130 11:3054050-3054072 TCCTCCCCACGATTCATGTCTGG - Intronic
1083252475 11:61477358-61477380 TCCTGCCCATGTTACATGTGAGG - Intronic
1088582371 11:111328415-111328437 TGCCCCCCACATTACAGGTTAGG + Intergenic
1089827759 11:121293963-121293985 TGCTCCCCACTTTATAGATAGGG - Intronic
1090652994 11:128823645-128823667 CGGTCCCCACTTTACAAGTAAGG + Intergenic
1099955269 12:89347165-89347187 TTCTCCCCACTTCACATGAAGGG + Intergenic
1102010595 12:109616171-109616193 AGCCCCCCACTTTACATGTGGGG - Intergenic
1102028962 12:109729099-109729121 TGCTCCTCATGTTACCTGCATGG - Intronic
1102803657 12:115760238-115760260 TGATCCCCATTTTACAGGTAAGG + Intergenic
1109842440 13:67937119-67937141 TTTTCCCCAAGTTACATGTGAGG - Intergenic
1113459029 13:110468857-110468879 TTCTCCCCACTTTACAGGTGAGG + Intronic
1114667043 14:24384261-24384283 TTCTCCCCACCTCACATGCATGG - Intergenic
1118514220 14:66508584-66508606 TCCTCCCCCGGTTACCTGTAAGG - Exonic
1121003466 14:90470011-90470033 TCCTCCCCAGGTTACAAGTTTGG - Intergenic
1123816950 15:23990073-23990095 TGCTCCCCAGGTAACATGGAAGG + Intergenic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1128692298 15:69734265-69734287 TTATTCCCACTTTACATGTAAGG + Intergenic
1129670222 15:77603760-77603782 AGTTGCCCACGTAACATGTAAGG - Intergenic
1130705944 15:86233031-86233053 TGATCCCCATTTTACATGCAAGG + Intronic
1134260150 16:12644603-12644625 TTGTCCCCACTTTACAGGTAAGG - Intergenic
1143635100 17:8159880-8159902 TGCTCCCCAGTTTTCATGTGGGG - Exonic
1147945386 17:44077596-44077618 TGCTCCCCACCTTACTCGGATGG - Exonic
1148193187 17:45694432-45694454 TGGTCCCAACATTTCATGTAAGG + Intergenic
1151605381 17:75131994-75132016 TTCACCCCACGTTACTAGTAGGG + Intergenic
1161100813 19:2420697-2420719 TGCTTCCCACTTTACATATGGGG - Intronic
1162110211 19:8395948-8395970 TGCTCCCCAAGTGACTTGTCTGG - Intronic
1167563483 19:50240925-50240947 TGCTTCCCATGTTACAGATAGGG - Intronic
1168147141 19:54426158-54426180 TGCTCCCCACGTTACATGTAGGG + Intronic
926018937 2:9477571-9477593 TTCTCCTCACTTTACATGTGAGG + Intronic
927337972 2:21947427-21947449 TGCTCCACATGTCACATGTGAGG - Intergenic
933291795 2:80445957-80445979 TACTCCCCATTTTACAGGTAAGG - Intronic
933464768 2:82638682-82638704 TAATCCCCATGTTACATGGAAGG + Intergenic
938106080 2:128530650-128530672 TTCTCCCCACTTTACAAGTGAGG + Intergenic
938228904 2:129640876-129640898 TACTTCCCATTTTACATGTAAGG + Intergenic
938740433 2:134226587-134226609 TGCTTCCCATTTTACATGTGTGG - Intronic
942754400 2:179322370-179322392 TGCTTCCCAGGCTACATGTTAGG - Intergenic
944687623 2:202131796-202131818 TGCACCCCAGGGTACATGCAGGG + Intronic
947072728 2:226309152-226309174 TGCTCCCCATGACACATGTCTGG - Intergenic
948174039 2:235929080-235929102 GGCTCCCCTGCTTACATGTAGGG - Intronic
948289431 2:236814173-236814195 TGCTCCCCACGGTACCTCGATGG + Intergenic
1172215645 20:33233812-33233834 TGCTCCCCATTTTACAGGTGAGG + Intergenic
1178721570 21:35015198-35015220 TGATCCCCACGTCACAGGTGTGG - Intronic
953947005 3:47157962-47157984 TGATCCCCACTTTATAGGTAAGG + Intronic
955102278 3:55861837-55861859 TTCTCCCCAAGTTACAGGGAAGG - Intronic
955700464 3:61677378-61677400 TTCTTCCCACTTTACATGTGAGG + Intronic
957264617 3:77946786-77946808 TGCTACCAACTTTCCATGTAAGG - Intergenic
958011806 3:87888731-87888753 GGCTCCCCATTTTACATATAAGG - Intergenic
962198577 3:133383314-133383336 TCCTCCACACCTTACAGGTAGGG + Intronic
962372901 3:134835519-134835541 TGCTCCCCCAGTTATAGGTAAGG + Intronic
967960109 3:194913624-194913646 TCCTCCCCAAGTCACATGAAAGG + Intergenic
974700000 4:65430143-65430165 TGCTGCTCAAGTCACATGTAAGG + Intronic
977017070 4:91704921-91704943 TGCTCCCTACTCTACCTGTAAGG + Intergenic
978342782 4:107735587-107735609 TGTTGCCCACTTTACATGAAAGG - Intergenic
987854854 5:23407536-23407558 TGCTCCCCATGTCAAAAGTAGGG + Intergenic
1004880373 6:20001679-20001701 TCCTCCCCATGTTATAGGTAAGG + Intergenic
1011892721 6:92187062-92187084 TGCTCCCCACCTCACCTGTCAGG + Intergenic
1015295977 6:131593073-131593095 TGCTCTCCATGTTACTTGTGTGG - Exonic
1017848435 6:158280968-158280990 TACTCCTCACGTTTAATGTAAGG - Intronic
1022652908 7:32293577-32293599 TACTCCCCATTTTACATGTGAGG + Intronic
1023878371 7:44305239-44305261 TGCTCCCCATGTCACAGGAAGGG + Intronic
1033452003 7:141470595-141470617 CGCTACCCACGCTACCTGTACGG + Exonic
1033903061 7:146166975-146166997 GGCTTCCCACCTGACATGTAGGG + Intronic
1036199961 8:6762177-6762199 TTCTCCCCTCTTTACAGGTAAGG - Intergenic
1041573776 8:59369698-59369720 TGTACCCCAACTTACATGTATGG - Intergenic
1048692982 8:136989052-136989074 TGCTCACCACGTTGCAGGCAAGG - Intergenic
1048753457 8:137705334-137705356 TGCTCCCAATGTTAAATGTGGGG - Intergenic
1056062237 9:82895691-82895713 TGCTCTCCAACTTACATGTTGGG + Intergenic
1056951650 9:91044857-91044879 TGCTTCCCACCTTAAATGTTTGG + Intergenic
1060238292 9:121882071-121882093 TGCTTGCCACGTTCCAGGTATGG - Intronic
1060667783 9:125443296-125443318 TGATCCCCACTTTACAGGTGGGG + Intronic
1061316460 9:129799364-129799386 TGATCCCCACTTTACAGTTAGGG + Intergenic
1061712751 9:132499068-132499090 TGCTGCTCACGTTACAAGAATGG + Intronic
1189025139 X:37386764-37386786 TTATCCCCACTTTACAGGTAAGG - Intronic
1190746363 X:53324908-53324930 TGCTACACACTTTACATATAAGG + Intergenic
1190752922 X:53377657-53377679 TTCTCCCCACTTTACAGATAAGG - Exonic
1194456005 X:94104484-94104506 TAATCCCCACGTTTCATGTGAGG - Intergenic
1199338399 X:146646368-146646390 TCCTACCCACGTTAAATGTGTGG + Intergenic