ID: 1168147614

View in Genome Browser
Species Human (GRCh38)
Location 19:54428861-54428883
Sequence CGGGTGGGGAGGGGTGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1787
Summary {0: 1, 1: 0, 2: 12, 3: 148, 4: 1626}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168147614_1168147628 10 Left 1168147614 19:54428861-54428883 CCCCCTGCACCCCTCCCCACCCG 0: 1
1: 0
2: 12
3: 148
4: 1626
Right 1168147628 19:54428894-54428916 AGACTTTCAGATTTCAGCCCTGG 0: 1
1: 1
2: 2
3: 23
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168147614 Original CRISPR CGGGTGGGGAGGGGTGCAGG GGG (reversed) Intronic
900095191 1:937390-937412 TGGGTGGGGGGGGGGGCAGGTGG - Intronic
900096416 1:941864-941886 CCGCAGGGGAGGGGAGCAGGCGG + Intronic
900121449 1:1050168-1050190 CGGCTGGCATGGGGTGCAGGAGG + Intronic
900186722 1:1336382-1336404 CGAGTGGGGTGGGGAGCAGCTGG - Exonic
900186983 1:1337281-1337303 AGGCCAGGGAGGGGTGCAGGTGG - Intronic
900189947 1:1349140-1349162 CGGGCCGGGCGGGGCGCAGGCGG - Intronic
900204838 1:1427419-1427441 GGGGTGGAGAGGGGAGCGGGCGG - Intronic
900297490 1:1959339-1959361 CAGGTGGGGGTGGGTGGAGGGGG - Intronic
900337136 1:2169797-2169819 CGGGGGGGGCGGGGTGCACGTGG + Intronic
900385324 1:2407958-2407980 CGGCTGTGGAGGGGAGAAGGTGG + Intronic
900527041 1:3134467-3134489 CGGGAGGGGAGGGCAGGAGGGGG - Intronic
900589208 1:3452270-3452292 CAGGGAGGGAGGGGAGCAGGTGG + Intergenic
900762524 1:4482665-4482687 CGGGAGGGCAGGGCTGCAGCAGG - Intergenic
900876833 1:5348929-5348951 CGCATGGGGAGGGGTGGTGGTGG - Intergenic
900972127 1:5997470-5997492 CAGGTGGGCAGGTGTGCAGTGGG - Intronic
901060895 1:6471462-6471484 CGGGCGGGGCCGGGCGCAGGCGG - Intronic
901075356 1:6551409-6551431 TGGCGGGGGTGGGGTGCAGGGGG - Intronic
901262155 1:7880414-7880436 GGGGTGGGGAGGGGGGAGGGGGG + Intergenic
901319406 1:8330417-8330439 CGGGTGGGGACGGGGGCAGCGGG - Exonic
901325896 1:8364901-8364923 CCGGTGGGGTGGGGGGGAGGGGG + Intronic
901625446 1:10622114-10622136 AGGGTGTGGAGGGGTGGAGGTGG - Intronic
901630726 1:10646964-10646986 AGGATGCAGAGGGGTGCAGGAGG + Intronic
901638957 1:10683699-10683721 CCGCAGGGGAGGGTTGCAGGTGG - Intronic
901678648 1:10900897-10900919 AGGGTGGGGAGAGGTGGAGAGGG + Intergenic
901741184 1:11343025-11343047 GAGGTGGGGAGAGGAGCAGGAGG + Intergenic
901923218 1:12550477-12550499 TGGCTGGGGAGGGGTGGAGCAGG + Intergenic
901930870 1:12595590-12595612 CGGGTGAGGAGGGGGCCAGGTGG + Intronic
902242009 1:15095599-15095621 GGGGTGGGGCGGGGTGGGGGTGG - Intronic
902279276 1:15362522-15362544 AAGGTGGAGAGGGCTGCAGGTGG + Intronic
902403584 1:16171452-16171474 TGGGTGGGGTGGAGTGAAGGGGG + Intergenic
902513091 1:16976650-16976672 AGGGTGGGGAGGGGTGAGGCAGG + Intronic
902585713 1:17437889-17437911 CGGGGGGGGAGGGGCGCAGAGGG + Intronic
902661571 1:17907756-17907778 CGGGTGTAGTGGGGTGGAGGTGG + Intergenic
902702751 1:18183791-18183813 CGGGTGGCGGGTGGTGCGGGGGG + Intronic
902776177 1:18676398-18676420 AGGGTGGGGAGGGGGGCAGCGGG + Intronic
902800734 1:18828334-18828356 AGGGTGGGAAGGTGTGAAGGAGG - Intergenic
902835389 1:19043770-19043792 TGGGTGGGAGGGGGTGGAGGGGG + Intergenic
902897389 1:19488366-19488388 GGGGTGGGGAGGGGCTGAGGTGG - Intergenic
902936700 1:19769737-19769759 GGGGTGGGGAGGAGCTCAGGAGG + Intronic
903047583 1:20575933-20575955 GGGTTGGGGATGGGTGCAGAGGG - Intergenic
903179483 1:21598062-21598084 GGCCTGGGGAGGGGGGCAGGAGG + Exonic
903212797 1:21828210-21828232 CCGGAGGGGAGGGGCACAGGTGG - Intronic
903236933 1:21956424-21956446 CGGTTGGGGGTGGGTGCAGGGGG - Intergenic
903281211 1:22251024-22251046 CGGGAGGGGAGGGGAGGACGAGG - Intergenic
903622468 1:24707825-24707847 GGGGGGGGGGGGGGTGGAGGGGG + Intergenic
903652171 1:24929162-24929184 CGCGGGAGGAGGGGTGCTGGAGG + Intronic
903788761 1:25878422-25878444 GGGGTGGGGTGGGGTGGGGGTGG - Intergenic
903907342 1:26696299-26696321 CGGGTGGGGAGGGCAGCCCGGGG + Exonic
904040268 1:27580241-27580263 CTGCTGGGAAGGGGTGGAGGTGG - Intronic
904043006 1:27594832-27594854 AGGGTGCCGTGGGGTGCAGGCGG + Intronic
904081541 1:27875535-27875557 TGGGTGGGGCTGGGTTCAGGTGG + Intronic
904260690 1:29285955-29285977 CAGGTGGGGAAGGGTGGAGCTGG - Intronic
904328319 1:29741923-29741945 GGGGTGGGGTGGGGAGGAGGAGG - Intergenic
904359498 1:29962746-29962768 CAGGTGGTGAGAGGAGCAGGCGG + Intergenic
904402153 1:30263937-30263959 GGGGTGGGGGGCGGTGGAGGTGG - Intergenic
904429313 1:30451749-30451771 CTGGTGGGGGGGGGAGCTGGGGG + Intergenic
904470369 1:30732184-30732206 CGTGTGTGGAGGGGTGTGGGGGG + Intergenic
904696946 1:32336135-32336157 CCGAGGGGGAGGGGTGCCGGGGG + Exonic
904965499 1:34369473-34369495 AGCCTGGGGAGGGGTGAAGGTGG + Intergenic
905028186 1:34865511-34865533 CGGCTGGGGAGGGGAGATGGGGG - Exonic
905580919 1:39082061-39082083 CAGGTGGGGAGGGTCGCAGGGGG + Intronic
905892431 1:41525835-41525857 GCGGTGGGGAGGGTGGCAGGGGG + Intronic
906057087 1:42925700-42925722 TGTGTGGGGAGGGGTGCAGGAGG + Exonic
906078316 1:43068136-43068158 CGACTGGGGAAGGGAGCAGGAGG + Intergenic
906274528 1:44506268-44506290 CGGGTGTGGAGGGGTGAAGGGGG + Intronic
906322808 1:44827363-44827385 CGGGCAGGGAGGGGTGCTGCAGG - Intronic
906715427 1:47965197-47965219 GGGGCGGGGGGGGGTGGAGGGGG + Intronic
906962652 1:50427826-50427848 CGGGTGTGGAGGGGTGCATTGGG - Intergenic
907237473 1:53062126-53062148 CGGGTGGGGAGTGGGGGAAGGGG + Intronic
907275606 1:53315111-53315133 CAGGAGGGGTGGGGTGCAGAAGG - Intronic
907284512 1:53371220-53371242 CGGCTGGGGTGGGGGGCAGCAGG - Intergenic
907316466 1:53575774-53575796 TGGGCTGGGATGGGTGCAGGAGG + Intronic
907332151 1:53678331-53678353 GGGGGGGGGTGGGGGGCAGGGGG + Intronic
907621330 1:55983556-55983578 GGGGAGGGGAGGGGAGTAGGGGG + Intergenic
907706550 1:56837521-56837543 CCTCTGGGGAGGGCTGCAGGAGG + Intergenic
908316207 1:62935367-62935389 AGGGTGGGGAGTGGAGCTGGGGG - Intergenic
909934847 1:81539320-81539342 CTGGTGGGGAGGGGTGGTGGTGG - Intronic
909953971 1:81754461-81754483 GGGGAGGGGAGGGGAGAAGGGGG - Intronic
910581242 1:88827642-88827664 CGGGAGGGGAGGGGAGAAGAGGG - Intronic
910840880 1:91560315-91560337 CGGGTGCGGAGGGGTGGGGGCGG - Intergenic
911055867 1:93708034-93708056 CAGGAGGGGAGGGGTGCGGGAGG + Intronic
912174775 1:107141538-107141560 CGGGTGGGGCGGGGGGCGGCGGG - Intronic
912395163 1:109336733-109336755 CGGGAGGTGGGGGCTGCAGGGGG + Intronic
912416351 1:109510341-109510363 GGAGTGGGGAGAGGTGCATGAGG - Intergenic
912448953 1:109758124-109758146 GTGGTGGGGAGGGGTGCGGGGGG - Intronic
912630672 1:111244036-111244058 CTTGTGGGGAGGGGTGCAACTGG + Intergenic
912631228 1:111248339-111248361 TTGGTGGGGAGGGGCACAGGAGG - Intergenic
912965172 1:114230868-114230890 TGGGAGGGGAGGGGAGCAGACGG + Intergenic
913275801 1:117136710-117136732 GGGGTGGGGTGGGGGGTAGGGGG + Intergenic
913368798 1:118073012-118073034 GGGGTGGGGATGGGGGAAGGAGG + Intronic
913681206 1:121187785-121187807 AGGGTGGGGGGAGGGGCAGGAGG + Intronic
914033036 1:143975425-143975447 AGGGTGGGGGGAGGGGCAGGAGG + Intergenic
914044314 1:144077986-144078008 GGGGGGGGGAGGGGTGGGGGAGG - Intergenic
914133795 1:144882699-144882721 GGGGGGGGGAGGGGTGGGGGAGG + Intergenic
914156409 1:145092541-145092563 AGGGTGGGGGGAGGGGCAGGAGG - Intronic
914221605 1:145686870-145686892 CGGGAGGGCAGGGATGGAGGTGG - Intronic
914300954 1:146376706-146376728 GGGGTGGGGGGGGGTGGGGGGGG + Intergenic
914750881 1:150534189-150534211 CTGGAGAGGTGGGGTGCAGGAGG + Intergenic
914824409 1:151131345-151131367 AGGGTGGTGGGCGGTGCAGGTGG + Intergenic
915099857 1:153491351-153491373 TGGGAGGAGAGGGGTGCAGAAGG - Intergenic
915262438 1:154686950-154686972 AGGTTGGGGAGGGGTGCCAGGGG - Intergenic
915270522 1:154750306-154750328 TGGGTGAGGAGGGGTGCAGGAGG - Intronic
915271348 1:154755935-154755957 AGGATGGGGAGGGGAGGAGGAGG + Intronic
915271399 1:154756183-154756205 AGGATGGGGAGGGGAGGAGGAGG + Intronic
915555298 1:156657820-156657842 AGGGTCGGGAGGGGTGGGGGTGG - Intronic
915589886 1:156864708-156864730 GTGCTGGGGAGGGGTGCAGGAGG - Exonic
915622299 1:157093024-157093046 CGGGAGGGGAGGAGTGAAGGAGG + Exonic
915878820 1:159643456-159643478 GGGGAGGGGAGGGGAGCGGGGGG + Intergenic
915910751 1:159913841-159913863 GGGGTGGGGTGCGGTGCAGGTGG - Intergenic
916215921 1:162394640-162394662 GGGGTGGGGTGGGGTGGAGTGGG - Intergenic
916694349 1:167221196-167221218 CGGGGTGGGCCGGGTGCAGGAGG - Intronic
916809829 1:168295756-168295778 GGGGTGGTGGGGGGTGCATGTGG + Intronic
917105004 1:171483322-171483344 AGGGAGGGGAGGGGAGAAGGAGG + Intergenic
917448101 1:175123730-175123752 GGGCTGGGGAGGGGAGCAGGAGG + Intronic
917455773 1:175184380-175184402 AGGGTAGGGAGTGGGGCAGGAGG - Intronic
917705526 1:177630223-177630245 CGGAAGGGAATGGGTGCAGGAGG + Intergenic
917865514 1:179190598-179190620 GGGGTGGGGTGGGATGGAGGGGG + Intronic
918041610 1:180917122-180917144 CAGGTGGTGGGGGGAGCAGGAGG + Intronic
918445680 1:184614576-184614598 TGGGTGGGGCGGGGTGGGGGTGG + Intronic
918543540 1:185657616-185657638 GGGGTGGGGAGGGGAGAAGGGGG - Intergenic
918952757 1:191160710-191160732 GGGATGGGGAGGGGAGGAGGAGG + Intergenic
919814571 1:201429493-201429515 AGGGTGGGGAGGGCAGCATGGGG - Intronic
919862539 1:201750376-201750398 AGGGTGGGGAGGGGAGGAAGAGG + Intronic
920035904 1:203065304-203065326 TGGGTGGGGGCGGGTGCAGAGGG - Intronic
920040192 1:203090401-203090423 GGGGTGGGGGGGGGTGGGGGGGG + Intergenic
920181407 1:204134241-204134263 AGGGTGGGGAGTGGAGTAGGCGG + Intronic
920333663 1:205229545-205229567 CGGGGGGGGGGGGGTGGTGGCGG + Intronic
920356380 1:205376285-205376307 CGGGTGGGGAGAGATGCGGCTGG - Intergenic
920401085 1:205676772-205676794 GGGCTGGGGAGGGGGGCAGCTGG - Intronic
920468521 1:206206310-206206332 AGGGTGGGGGGAGGGGCAGGAGG + Intronic
920875955 1:209836031-209836053 GGGGTGGGGCAGGGTGCAGAGGG - Intronic
921416486 1:214893757-214893779 TGGGTGGGGTGGGGAGGAGGTGG + Intergenic
921836318 1:219782496-219782518 GGGGTGGGGTAGGGGGCAGGGGG - Intronic
922028262 1:221773694-221773716 AGGGTGGGGAGGCCTGTAGGTGG + Intergenic
922174880 1:223189435-223189457 CAGGTGGGGGCTGGTGCAGGTGG + Intergenic
922174942 1:223189643-223189665 CAGGTGGGGGCTGGTGCAGGTGG + Intergenic
922174973 1:223189755-223189777 CAGGTGGGGGCTGGTGCAGGTGG + Intergenic
922203288 1:223425070-223425092 GGGGTGGGGTGGGGTGGTGGTGG - Intergenic
922558693 1:226551411-226551433 CAGGTGGAGAGGGGAGCAGAGGG - Intronic
922818818 1:228470412-228470434 TGGGCTAGGAGGGGTGCAGGGGG + Intergenic
922881877 1:228987217-228987239 CGTGTGGGGGGGGGTGGGGGGGG - Intergenic
922916261 1:229260058-229260080 TGGGTGGGGAGGGGGGGTGGTGG + Intergenic
923037064 1:230291885-230291907 GAGGTGGGGAGCGGTGAAGGAGG + Intergenic
923211929 1:231811273-231811295 GGGTTGGGGAGGGGAGCAGTTGG + Intronic
923309824 1:232725290-232725312 GGGGAGGGGAGGGGGGGAGGGGG + Intergenic
923309867 1:232725353-232725375 GGGGAGGGGAGGGGGGGAGGGGG + Intergenic
923309891 1:232725387-232725409 GGGGAGGGGAGGGGGGGAGGGGG + Intergenic
923401576 1:233619924-233619946 CGGGGGGGCGGGGGGGCAGGGGG + Intronic
923458713 1:234188340-234188362 CTGGTGAGGTGGGGGGCAGGGGG + Intronic
923660124 1:235950526-235950548 GGGGTTGGGAGGGAAGCAGGAGG - Intergenic
924442961 1:244102218-244102240 GGCGGGGTGAGGGGTGCAGGCGG - Intergenic
924453380 1:244198954-244198976 CAGGTGGGGTGAGGTGAAGGCGG - Intergenic
924624752 1:245688831-245688853 CGGGTGAGGAGGGCGGCAGGTGG + Intronic
924741647 1:246797591-246797613 CTGGCGGGGAGGGGGGCGGGGGG - Intergenic
1062908930 10:1199622-1199644 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1063126670 10:3142290-3142312 CAGATGGGGAGGTGTGTAGGAGG - Intronic
1063171677 10:3515295-3515317 GTGGTGGGGCGGGGGGCAGGGGG - Intergenic
1063207566 10:3849107-3849129 GGGGAGGGGAGGGGGGAAGGGGG - Intergenic
1063223429 10:3992495-3992517 GGGGAGGGGAGGGGAGAAGGTGG - Intergenic
1063580309 10:7300543-7300565 TGGGTGGGCAGGGGTTGAGGAGG - Intronic
1063663309 10:8048314-8048336 CGGGTGAGGTGGGGTGCACGCGG - Intergenic
1063996929 10:11628484-11628506 CGGGTGGGGAGTGGTAAATGTGG - Intergenic
1064174873 10:13066229-13066251 CGGGAGGGCAAGGGTGCAGTGGG - Intronic
1064533040 10:16329589-16329611 CGGGTGGGAAGGAGGGAAGGAGG + Intergenic
1064766698 10:18682684-18682706 CGGATGGGGAGTGGAGCAGAAGG - Intergenic
1065117699 10:22498349-22498371 GGGGTTGAGAGGGGTGAAGGTGG + Intergenic
1065720289 10:28622419-28622441 GGGGGGGGGGGGGGGGCAGGGGG - Intronic
1065856971 10:29838886-29838908 GAGATGGGGAGGAGTGCAGGAGG + Intergenic
1065856981 10:29838909-29838931 GAGGAGGGGAGGGGTGCTGGAGG + Intergenic
1065973455 10:30822927-30822949 CAGGTGGGAAGGGTTGAAGGTGG - Intronic
1066022648 10:31319143-31319165 GGAGGGGGGAGGGGTGGAGGCGG + Intronic
1067085774 10:43237436-43237458 GGGGAGGGGAGGGGAGGAGGGGG - Intronic
1067214819 10:44293131-44293153 TGGGTGGGGAGGGGGGCCTGGGG + Intronic
1067544891 10:47185393-47185415 AAGGTGGGGAGGGGCCCAGGCGG - Intergenic
1067570123 10:47365428-47365450 TGGCTGTGGAGGGTTGCAGGAGG - Intergenic
1068413107 10:56683655-56683677 CTGGTGGGGATGGGGGCATGTGG - Intergenic
1068595169 10:58895571-58895593 CGGGGGGGGGGGGGGGCGGGGGG - Intergenic
1069274044 10:66567082-66567104 GGAGTGGGGAGGGGTTTAGGTGG + Intronic
1069424689 10:68279054-68279076 CGGCGGGGGAGGGGTGCGGCGGG + Intergenic
1069515232 10:69072016-69072038 GGGGTGGGGGGGGGGGCAGGTGG + Intergenic
1069592030 10:69648071-69648093 CTGGTGGGGAGTGTGGCAGGTGG + Intergenic
1069607290 10:69747704-69747726 GGGGTGGCCAGGGGTGCAAGGGG + Intergenic
1069637180 10:69932030-69932052 GGGGAGGGCAGGGGCGCAGGTGG - Intronic
1069705538 10:70457004-70457026 AGGCAGGGGAGGGGGGCAGGGGG - Intergenic
1069717633 10:70531169-70531191 GGGATGGTGTGGGGTGCAGGAGG + Intronic
1069723939 10:70565773-70565795 CCCCTGGGGAGGGGTGGAGGTGG + Intronic
1069782094 10:70963258-70963280 GGGGTGGGGAGGGGACCACGGGG + Intergenic
1069939126 10:71941675-71941697 GGGGGGGAGAGGGGGGCAGGGGG + Intergenic
1069961062 10:72079813-72079835 TTGGTGGTGAGGGGTGTAGGGGG - Intronic
1070496915 10:77033041-77033063 TGGGTGGGGTTGGGTTCAGGGGG - Intronic
1070654446 10:78261799-78261821 GGGGTGGGGTGGGGAGCAAGAGG + Intergenic
1070658207 10:78285719-78285741 GGGGTGGGGAGAGGTGAAGCGGG + Intergenic
1070703148 10:78618040-78618062 GGGGTGGGTGAGGGTGCAGGAGG - Intergenic
1070806694 10:79274959-79274981 GGGGTGGGGCGGGCAGCAGGCGG + Intronic
1070976479 10:80609610-80609632 GGGTTGGGGAGGGGTGCTGAAGG + Intronic
1071283731 10:84125560-84125582 GGGGTGGGGAGGGGGCGAGGAGG - Intergenic
1071430374 10:85602245-85602267 AGGGTGGGCAGGAGGGCAGGCGG + Exonic
1071752974 10:88502340-88502362 GGGGTGGGGAGGTGAGGAGGGGG + Intronic
1072406578 10:95159769-95159791 GTGGTGGGGTGGGGGGCAGGAGG + Intergenic
1072528009 10:96291379-96291401 CGGGTGGGATGGGGTGGAGTGGG - Intergenic
1072615916 10:97048860-97048882 CAGGTGGGCAGGTATGCAGGTGG + Intronic
1072615936 10:97048924-97048946 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1072696812 10:97609843-97609865 GGGGTGGCGAGGCCTGCAGGAGG + Intronic
1072711526 10:97718666-97718688 CAGGTGGGGTGTGGTCCAGGAGG - Intergenic
1072737517 10:97889121-97889143 CGGGAGGGAAGGGGGGGAGGGGG + Intronic
1072758460 10:98036591-98036613 TGTGTGAGGAGGGGTGGAGGAGG + Intergenic
1073076685 10:100828913-100828935 CGGGCGGGGCGGGGCGGAGGGGG - Exonic
1073094077 10:100969471-100969493 CGGGGGGGGGGTGGTGGAGGCGG - Intronic
1073207376 10:101776174-101776196 AGGGCGGGGAGGGGTGGGGGCGG + Intronic
1073452075 10:103616020-103616042 GGGGTGGGGCGGGGTGGGGGCGG + Intronic
1073847468 10:107574169-107574191 AGGGAGGGGAGGGGTGCATGTGG + Intergenic
1074086124 10:110210025-110210047 GGGGTGGGGGGTGGGGCAGGGGG - Intronic
1074440485 10:113473410-113473432 GGGCTGGGGAGGGGTTCAGAGGG + Intergenic
1074960849 10:118444516-118444538 GGGGTGGGGGGTGGGGCAGGTGG - Intergenic
1075710936 10:124530207-124530229 GGGGTGGGGCGGGAGGCAGGAGG - Intronic
1075802210 10:125160587-125160609 AGGGTGGGGAGGGCGGGAGGGGG - Intronic
1076193633 10:128499742-128499764 CAGGTGGGGAGGGGCCCAGCAGG + Intergenic
1076317795 10:129555149-129555171 CGGGTAGGGCAGGGTGGAGGTGG - Intronic
1076318510 10:129561304-129561326 GGGGTGGGTCAGGGTGCAGGCGG + Intronic
1076379015 10:130012343-130012365 CAAGTGGCGAGGGGTGCAGGTGG + Intergenic
1076435559 10:130438861-130438883 GGGGTGCAGTGGGGTGCAGGGGG - Intergenic
1076546107 10:131246606-131246628 GGGGTGGGGTGGGGTGCGGTGGG - Intronic
1076554300 10:131311835-131311857 CCGGCGGGGAGGGGCGCGGGCGG - Intergenic
1076653540 10:132006205-132006227 GGGGTGGGGTGGGGTGGGGGGGG + Intergenic
1076798233 10:132809060-132809082 CGGTGCGGGAGGGGTGCGGGTGG - Intronic
1076845565 10:133067988-133068010 CGGCTGGGGGTGGGAGCAGGGGG - Intergenic
1076853179 10:133103029-133103051 CTGGAGGGGAGGGGCGCCGGAGG + Intronic
1076869831 10:133187892-133187914 AGGGCGGGACGGGGTGCAGGGGG - Intronic
1076876777 10:133220110-133220132 CAGGTGAGGAGGGGCTCAGGCGG + Exonic
1076876817 10:133220238-133220260 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876837 10:133220302-133220324 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876857 10:133220366-133220388 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876885 10:133220462-133220484 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876895 10:133220494-133220516 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876905 10:133220526-133220548 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876915 10:133220558-133220580 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876935 10:133220622-133220644 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876955 10:133220686-133220708 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876975 10:133220750-133220772 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076930382 10:133528257-133528279 CGGGTGGGGAGCAGAGCAGCTGG + Intronic
1077015927 11:399254-399276 CAGGTGGGGAGGAAGGCAGGGGG - Intronic
1077023651 11:430508-430530 GGGGTGGGAAGGGGTGGCGGGGG + Intronic
1077224804 11:1435260-1435282 CGGCGGAGGAGGGGTGCCGGTGG + Intronic
1077224816 11:1435289-1435311 CGGCGGAGGAGGGGTGCCGGTGG + Intronic
1077224828 11:1435318-1435340 CGGCGGAGGAGGGGTGCCGGTGG + Intronic
1077224840 11:1435347-1435369 CGGCGGAGGAGGGGTGCCGGTGG + Intronic
1077224852 11:1435376-1435398 CGGCGGAGGAGGGGTGCCGGTGG + Intronic
1077224864 11:1435405-1435427 CGGCGGAGGAGGGGTGCCGGTGG + Intronic
1077224876 11:1435434-1435456 CGGCGGAGGAGGGGTGCCGGTGG + Intronic
1077224888 11:1435463-1435485 CGGCGGAGGAGGGGTGCCGGTGG + Intronic
1077224900 11:1435492-1435514 CGGCGGAGGAGGGGTGCCGGTGG + Intronic
1077224912 11:1435521-1435543 CGGCGGAGGAGGGGTGCCGGTGG + Intronic
1077224924 11:1435550-1435572 CGGCGGAGGAGGGGTGCCGGTGG + Intronic
1077226343 11:1440543-1440565 GGGGTGGGGTGGGGTGAGGGTGG - Intronic
1077266400 11:1652955-1652977 CGGGTGGAGGGAGCTGCAGGAGG + Intergenic
1077305022 11:1865076-1865098 CAGGGGGGCAGGGGTGCGGGAGG + Intronic
1077336877 11:2009282-2009304 CGGGTGGGGAGGAGGGCTGTAGG - Intergenic
1077486089 11:2839017-2839039 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1077500285 11:2906931-2906953 GGGGAGGGGAGGGATGGAGGAGG + Intronic
1077921158 11:6642625-6642647 AGGGTGGGGTGGGGTGGGGGGGG + Intronic
1078057186 11:8018397-8018419 GGGGTGGGGAGGGGTGGGGCAGG - Intergenic
1078101081 11:8330707-8330729 CGGGTGGGGAGGAGGGACGGAGG - Intergenic
1078416012 11:11165459-11165481 CTGGTGGGCAGGTGTGCAGAGGG - Intergenic
1078609749 11:12809926-12809948 TGGGTGAGGAGGTGTGGAGGAGG + Intronic
1078758103 11:14230562-14230584 CGGCTGGGAAGGTGGGCAGGGGG - Intronic
1079076818 11:17389417-17389439 GGGGCGGGGAGGGGCGCGGGAGG - Intergenic
1079238049 11:18703437-18703459 CAAGTGGGGAGGGGAGGAGGTGG - Exonic
1079398835 11:20088983-20089005 CGGTTTGGGAGGTTTGCAGGAGG - Intronic
1080233624 11:30045245-30045267 CTCGTGGCGGGGGGTGCAGGGGG - Intergenic
1080574208 11:33583512-33583534 GTGGTGGGGAGAGGGGCAGGAGG + Intronic
1080635650 11:34121040-34121062 AGGGTGAGTAGGGGTGGAGGAGG + Intronic
1080682054 11:34486313-34486335 TGGGTGGGGAGTGGGACAGGTGG + Intronic
1080944037 11:36950961-36950983 AAGGGGGGGAGGGGTGCAAGTGG + Intergenic
1081489853 11:43558757-43558779 CGGGGGCGGAGGGGTGCAGCTGG + Intronic
1081526068 11:43928588-43928610 CGAGTGGGGAGCGGAGGAGGTGG + Intronic
1081575867 11:44318257-44318279 GGGGTGGGGGGCGGGGCAGGTGG - Intergenic
1081796680 11:45825375-45825397 CTGGTGGGGAGGGTGTCAGGGGG - Intergenic
1081807867 11:45900063-45900085 CGGGCGGGGGGCGGTGCAAGCGG + Intronic
1081834445 11:46142763-46142785 CGGGTGGGAGGAGGTCCAGGTGG - Intergenic
1081891366 11:46545161-46545183 CGGGGGGGGGGGGGTGGTGGTGG + Intronic
1082798328 11:57394866-57394888 GGTGTGGGGAGGGATGCAGGTGG - Intronic
1083324307 11:61865709-61865731 CCGTGGGGAAGGGGTGCAGGTGG + Exonic
1083340417 11:61955467-61955489 CGGGAGGGGAGGGGGTCTGGCGG + Intronic
1083672207 11:64305815-64305837 CGGGCGGGGCGGGCTGCAGGCGG + Intronic
1083694593 11:64434235-64434257 AGGGTGGGGTGGGGGGCAGGGGG - Intergenic
1083731845 11:64656536-64656558 GGGGTGGGGAGGGATGCTGAAGG + Intronic
1083736609 11:64685236-64685258 GGGGTGGGGAGGGGTTCCTGTGG - Intronic
1083823332 11:65184465-65184487 GGGGCGGGGCGGGGTGGAGGCGG - Intronic
1083860498 11:65417705-65417727 AGGGTGGGGAGGGTTGGAGGAGG + Intergenic
1083879195 11:65539930-65539952 CAGGTGGGGTGGGGCGGAGGCGG - Intronic
1083931999 11:65851188-65851210 CCGCTGGGGAGAGGGGCAGGGGG - Intronic
1083960531 11:66012666-66012688 GGGGTGGGGGGGGGTGGGGGGGG - Intronic
1083960539 11:66012676-66012698 GGGGTGGGGGGGGGTGGGGGGGG - Intronic
1084104893 11:66975018-66975040 GGGGAGGGGAGGGGAGAAGGAGG + Intergenic
1084164749 11:67370374-67370396 CTGGTGGGGAGGGGGAGAGGGGG - Intronic
1084219466 11:67668279-67668301 TGGGTGGGCACAGGTGCAGGTGG + Intronic
1084271793 11:68033047-68033069 CGGGTGGGCACGGATGCATGGGG + Intronic
1084408176 11:68991073-68991095 CAGGTGGGAAGGGGAGCTGGGGG + Intergenic
1084481424 11:69422921-69422943 CAGGGGTGGAGGGGTGCCGGAGG - Intergenic
1084596120 11:70118054-70118076 GGGGTGCGGAGGGATGAAGGGGG - Intronic
1084785583 11:71440069-71440091 GGGATGGGGAGAGGAGCAGGTGG + Intronic
1084972119 11:72777682-72777704 AGGGAGGGAAGGGGTGGAGGTGG + Intronic
1085412784 11:76301470-76301492 TGGGTGGGGAGGGGCTCAGTTGG + Intergenic
1085561041 11:77473469-77473491 GGGGTGGGGACGGGTGGAGTGGG - Intronic
1085647932 11:78240045-78240067 GGAGTGGGGAGAGGGGCAGGTGG - Intronic
1085743566 11:79096483-79096505 GGGGTGGGGTGGGGTGGGGGAGG - Intronic
1086302050 11:85437145-85437167 TGCGTGGGGAGGGATGCAAGGGG + Intronic
1086561551 11:88175155-88175177 CGCGGGGGGAGGGGGTCAGGGGG - Intronic
1086737881 11:90329821-90329843 AGGGGGAGGAGGGGTGGAGGAGG - Intergenic
1086961019 11:92980174-92980196 CGGCTGGGATGGTGTGCAGGAGG - Intronic
1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG + Intronic
1087745526 11:101941294-101941316 CTGGTGGGGAGGGTAGCATGGGG - Intronic
1087841315 11:102923590-102923612 GGGGTGGGGAGGTATGGAGGTGG + Intergenic
1088689787 11:112315869-112315891 TGGGTGGGGAGAGGTGCTGGGGG + Intergenic
1088736620 11:112732895-112732917 AGGCTGGGGAGGGGAGCATGAGG - Intergenic
1088746420 11:112808376-112808398 GGGGTGAGGAGGGGAGGAGGAGG - Intergenic
1088870454 11:113886200-113886222 CGGGTTGCGGGGGGGGCAGGGGG - Intergenic
1088906681 11:114160273-114160295 TGGTTGGGGTGGGGTGAAGGAGG + Intronic
1088920595 11:114257705-114257727 AGGGAGGGGAGGGGAGCTGGGGG - Intergenic
1089058664 11:115608256-115608278 TGGGTGGGGGAGGGTGGAGGAGG + Intergenic
1089293010 11:117449877-117449899 AGGATGGGGATGGGTGCAGTGGG - Intronic
1089331476 11:117691872-117691894 AGGGTGGGTGGGGCTGCAGGGGG + Intronic
1089377799 11:118007094-118007116 GGGGTGGGGAGTGGAGAAGGAGG - Intergenic
1089401388 11:118166559-118166581 TGGGTGGGCAGGGGTAGAGGAGG - Exonic
1089478897 11:118790237-118790259 GGCGTGGGGCGGGGTGCGGGGGG - Intronic
1089564067 11:119361608-119361630 CTGGGGGGGAGGGGTGTGGGTGG + Intronic
1089624429 11:119742335-119742357 TGGGTGGGCAGGGGTGCGAGGGG + Intergenic
1089673879 11:120075969-120075991 GGGGTGGGGAGGAGGGGAGGTGG + Intergenic
1089915627 11:122153010-122153032 CGGGGGGCGGGGGGTGCGGGGGG - Intergenic
1090076092 11:123580829-123580851 GCGGTGGGGAGGTGTGCAGCAGG - Intronic
1090172008 11:124613464-124613486 GGGGAGGGGCGGGGTGCAGTTGG + Intronic
1090224824 11:125063531-125063553 CGCGTGGCCAGGGGTGCTGGGGG + Intronic
1090243890 11:125202300-125202322 CCCTTGGTGAGGGGTGCAGGGGG - Intronic
1090253810 11:125268963-125268985 GGGGTGGGGTGGAGGGCAGGGGG + Intronic
1090405398 11:126473238-126473260 TGGGTGGGGAGGGGGCTAGGTGG - Intronic
1090482540 11:127080869-127080891 GGGGTGGGGTGGGGTGGAGTGGG + Intergenic
1090670286 11:128941040-128941062 CAGAAGGGCAGGGGTGCAGGGGG + Intronic
1090807809 11:130213290-130213312 CGGGTGGGGCGGGGTGTCCGGGG + Intergenic
1090852336 11:130581278-130581300 AGGGTGGGAAAGGGTGAAGGCGG + Intergenic
1091224973 11:133951682-133951704 CAGGTGGGGAGAGGGGCAGTGGG - Intronic
1091236598 11:134026302-134026324 AGGGCGGGGAGTGGGGCAGGTGG - Intergenic
1091241128 11:134053142-134053164 CGGGGGGGGGGGGGTGGAGGAGG + Intergenic
1091314811 11:134606832-134606854 AGGGTGGGGAGTGCTGAAGGTGG + Intergenic
1202819861 11_KI270721v1_random:64464-64486 CGGGTGGGGAGGAGGGCTGTAGG - Intergenic
1091445345 12:541833-541855 GGGGTGGGGGGGGGTGAGGGGGG - Intronic
1091445351 12:541843-541865 GGGGTGGGGGGGGGTGGGGGGGG - Intronic
1091701226 12:2664746-2664768 CAGGTGGGGAGGGATGCAGAGGG + Intronic
1091793742 12:3285921-3285943 AGCTGGGGGAGGGGTGCAGGGGG - Exonic
1091807353 12:3366001-3366023 CGCGTGGGGTGGGGCGCCGGGGG - Intergenic
1091970759 12:4785004-4785026 GGGGTCTGGAGGGGTGCAGCAGG - Intronic
1092004453 12:5057369-5057391 TGGGTGTGGAGGGATGGAGGAGG + Intergenic
1092103158 12:5902656-5902678 AGGGAGGGGAGGGGAGGAGGGGG + Intronic
1092103170 12:5902676-5902698 GGGGAGGGGAGGGGAGGAGGGGG + Intronic
1092103182 12:5902696-5902718 GGGGAGGGGAGGGGAGGAGGGGG + Intronic
1092680452 12:10974257-10974279 AGACTGGGGTGGGGTGCAGGTGG - Intronic
1092963045 12:13614557-13614579 GGTATGGGGAGGGGTGCAGTGGG + Intronic
1093163236 12:15774316-15774338 CAGGGGGGGTGGGGTGAAGGAGG - Intronic
1093867217 12:24242716-24242738 GCGGTGGGGGTGGGTGCAGGGGG + Intergenic
1094318029 12:29153493-29153515 CAGTTGGAGAGGGGAGCAGGTGG + Intronic
1094334679 12:29335678-29335700 CTTGGGGGGTGGGGTGCAGGGGG - Intronic
1094783278 12:33817956-33817978 CAGTTGGGGAGGGGTACTGGTGG + Intergenic
1094809439 12:34123553-34123575 GGGGTGGGGAGGGGGGAGGGGGG - Intergenic
1094817906 12:34205041-34205063 TGAGTGGGGCGGGGGGCAGGGGG - Intergenic
1095752630 12:45729075-45729097 CTGGCGGGGAGGGAAGCAGGCGG + Intergenic
1095917603 12:47495964-47495986 GGGGCGGGTGGGGGTGCAGGGGG - Intergenic
1095950336 12:47778266-47778288 GGGGTGGGGAGCGGTGCAGGTGG + Intronic
1096154247 12:49332983-49333005 CGGGTGGGGCGGGCAGGAGGTGG + Exonic
1096191269 12:49621825-49621847 CCTGTGGGGAGGGCTGCAGCTGG + Intronic
1096259376 12:50081422-50081444 CGGGTGGGCGGGGGTGGACGGGG - Intronic
1096355568 12:50938182-50938204 GGGGGGTGGAGGGGTGCAGAGGG - Intergenic
1096528386 12:52228079-52228101 GGGGAGGGGAGGGGGGGAGGAGG - Intergenic
1096627322 12:52903839-52903861 GGGCTGGGGTGGGGTGGAGGAGG - Intronic
1096726256 12:53565492-53565514 GCGGGGGGGAGGGGGGCAGGGGG + Intronic
1096777751 12:53974310-53974332 GAGGAGGGGAGGGGTGGAGGGGG + Intronic
1096786075 12:54018084-54018106 CGAGTGGGGGCGGGAGCAGGGGG - Intronic
1096838992 12:54369776-54369798 CGTAGGGGGAGGGGAGCAGGCGG - Exonic
1097018176 12:56001976-56001998 CGGGTGGGGAATGGGGTAGGAGG - Exonic
1097261158 12:57720965-57720987 AGGGTGGGGAGGTGGGGAGGAGG - Exonic
1097265234 12:57740536-57740558 AGGGTGAGGAGGGGTGGAGGTGG - Intronic
1097270269 12:57769752-57769774 CAGGTGGGGAGGGGCCCTGGTGG - Exonic
1097804517 12:63950881-63950903 GGGGTGGGGTGGGGTGGAGTGGG - Intronic
1097962673 12:65547741-65547763 GGGGTGGGGAGGGAGGCAGGAGG - Intergenic
1098002893 12:65963407-65963429 GGGGTGGGGTGGGGTGGGGGAGG + Exonic
1098312122 12:69158788-69158810 CGGGTGGGGTGGGGGGCGGGGGG - Intergenic
1098929743 12:76397338-76397360 GGGGTGGGGAGGGGGGGTGGGGG + Intronic
1099189408 12:79547314-79547336 GAGATGGGGCGGGGTGCAGGGGG - Intergenic
1099997710 12:89796882-89796904 TGGGTGGGGAGGGGTGTGGAAGG - Intergenic
1100146309 12:91681940-91681962 GGGGTGGGGCGGGGCGGAGGGGG - Intergenic
1100315655 12:93442085-93442107 CGGTTGGGGCGGGGCGCACGGGG - Exonic
1100628204 12:96358832-96358854 GGGGTGGGGTGGGGTGGGGGCGG - Intronic
1100854441 12:98746287-98746309 CAGGTGGGCAGGGGTACTGGAGG - Intronic
1100861508 12:98811559-98811581 CTGGTGAGAAGGGGTCCAGGAGG - Intronic
1101150168 12:101877002-101877024 CGGGTGGGGTGCGGGGCAGGCGG - Intergenic
1101509177 12:105377272-105377294 CGGGTGAGGATGGGAGCAGGGGG + Intronic
1101955081 12:109205793-109205815 GGGGTGGGGATGGGTGTGGGTGG + Intronic
1101970468 12:109309160-109309182 GGGGTGGGCAGGGGTTCCGGAGG + Exonic
1102026045 12:109714747-109714769 CGGGTGGGAAGGGGCGCTGTCGG - Exonic
1102208989 12:111110824-111110846 AGGCTGGGGAGGCGTGAAGGGGG + Intronic
1102471747 12:113163329-113163351 CTGGTGGGTAGGGAGGCAGGGGG - Intronic
1102495556 12:113316671-113316693 CGGGTGGTGAGGTGTGCCTGCGG + Intronic
1102498152 12:113333650-113333672 AGGGTGGGGTGGGGGGCGGGGGG - Intronic
1102534535 12:113570654-113570676 AGGGTGGGCAGGGGGGCGGGGGG + Intergenic
1102563987 12:113782808-113782830 TGTGCGGGAAGGGGTGCAGGTGG + Intergenic
1102600511 12:114026176-114026198 GGGGAGGGGAGGGCTGCAGCAGG + Intergenic
1102756127 12:115342476-115342498 GGGGCGGGGTGGGGGGCAGGTGG - Intergenic
1102804493 12:115767689-115767711 CTGGTGGGGGTGGGGGCAGGGGG + Intergenic
1103173622 12:118843536-118843558 TGGGTGCCGAGGAGTGCAGGAGG + Intergenic
1103360471 12:120350628-120350650 CACGTGGGGTGGGCTGCAGGGGG - Intronic
1103409841 12:120703102-120703124 GGGGTAGGGAGGGGTGGAGGTGG + Intergenic
1103978541 12:124720373-124720395 GGGGTGGGGAGAGGTGGAGGTGG + Intergenic
1103980976 12:124736738-124736760 TGGGTGTGTAGGTGTGCAGGTGG - Intergenic
1104332035 12:127855934-127855956 GGGGTGGAGAAGGGTGTAGGTGG - Intergenic
1104387537 12:128364307-128364329 GGGGCGGGGAGGGGAGGAGGGGG - Intronic
1104414826 12:128589401-128589423 TGGGTTGGGAGGGAGGCAGGCGG - Intronic
1104731753 12:131108988-131109010 CAGGTGGGGATGGGGGGAGGTGG + Intronic
1104860442 12:131920790-131920812 TGGGCGGGAAGGGGGGCAGGAGG - Intronic
1104897163 12:132169897-132169919 CTGGTGGGGAGGGCAGCTGGAGG + Intergenic
1104954566 12:132457894-132457916 CGGGTGGGTAGGTGGACAGGTGG + Intergenic
1104954610 12:132458030-132458052 CGGGTGGGTAGGTGACCAGGTGG + Intergenic
1104954638 12:132458106-132458128 CGGGTGGGTAGGTGGACAGGTGG + Intergenic
1105039962 12:132954455-132954477 AGGGTGGGGAGGGGAGGAGAAGG + Intronic
1105293661 13:19070754-19070776 TAGGAGGGGAGGAGTGCAGGAGG - Intergenic
1105472336 13:20704511-20704533 AGGGTGGGGTGGGGTGCGAGGGG + Intronic
1105535236 13:21259679-21259701 CGGGCGGGGCGGGCTGCAGGCGG + Intergenic
1105649446 13:22358834-22358856 AGGGTGGGGAGTGGGGGAGGTGG - Intergenic
1105700670 13:22933495-22933517 GGAGCGGGGATGGGTGCAGGTGG - Intergenic
1105853465 13:24355650-24355672 GGAGCGGGGATGGGTGCAGGTGG - Intergenic
1106075442 13:26456776-26456798 GGGGCGGGGAGGGGGGCGGGTGG + Intergenic
1106168011 13:27266154-27266176 GGGGAGGGGAGGGGAGCAGAGGG - Intergenic
1106181374 13:27372212-27372234 CGGGGGGGGGGGGGGGGAGGTGG + Intergenic
1106547363 13:30742424-30742446 CTGCTGGGGAGAGGTGCAGCCGG - Intronic
1106833466 13:33610255-33610277 GGGGAGGGGAGGGATGAAGGTGG + Intergenic
1107093981 13:36515038-36515060 CCGGTGGTGCGGGGTGCGGGTGG + Intergenic
1107217184 13:37935075-37935097 GGGGGGGGTTGGGGTGCAGGCGG + Intergenic
1108459744 13:50653165-50653187 AGTGTGGGGTGGGGGGCAGGGGG + Intronic
1108526333 13:51288661-51288683 GAGGTGGGGGGGGGAGCAGGAGG - Intergenic
1108586079 13:51871037-51871059 ATGGTGGGGAGGGGGCCAGGCGG - Intergenic
1108782907 13:53858413-53858435 AGGGTGGGGAGGGGTGGGGGAGG - Intergenic
1108788050 13:53930916-53930938 CGGGGGGGGTGGGTGGCAGGTGG - Intergenic
1109274152 13:60285798-60285820 CTGTTGGGATGGGGTGCAGGGGG + Intergenic
1109763337 13:66860336-66860358 GGGGAGGGGAGGGGTGGTGGAGG + Intronic
1109915921 13:68984887-68984909 CTGGAGGGGAGGAGTCCAGGCGG + Intergenic
1110119630 13:71865875-71865897 CTGGTGGGAAGGGGCGCGGGCGG + Intronic
1110572985 13:77026725-77026747 GGGGTGGGGTGGGGTGGGGGGGG - Intronic
1110922663 13:81108506-81108528 GGGGTGGGGGGGGGTGGGGGGGG - Intergenic
1111230800 13:85341551-85341573 GGGAGGGGGAGGGGTGGAGGAGG + Intergenic
1111668143 13:91295735-91295757 AGGATGCGGCGGGGTGCAGGGGG - Intergenic
1112077727 13:95931541-95931563 AGGGTGGGGTGGGGTGGGGGTGG + Intronic
1112334308 13:98501361-98501383 GGGGTGGGGCGGGGGCCAGGAGG + Intronic
1112453188 13:99531483-99531505 GGGGTTGGGTGGGGTGGAGGAGG - Intronic
1113039194 13:106085711-106085733 GGGGTGGGGAGGGGGGGCGGGGG + Intergenic
1113300410 13:109013106-109013128 GGGGTGGGGGGGGGTGGGGGAGG - Intronic
1113465871 13:110512608-110512630 CGTGTGGGGACGGGTGCCTGAGG - Exonic
1113655739 13:112067090-112067112 CGGGGGGGGGGAGGCGCAGGGGG - Intergenic
1113868283 13:113543225-113543247 AGGGAGGGTAGGGGCGCAGGGGG - Intronic
1113909814 13:113836563-113836585 GGGGTGGGGAGGGGTGAGGGAGG + Intronic
1113909826 13:113836585-113836607 GGGGTGGGGAGGGGTGAGGGAGG + Intronic
1113909840 13:113836607-113836629 GGGGTGGGGAGGGGTGGGGGAGG + Intronic
1113939448 13:114010753-114010775 CGCGTGGGGAGGTGGGGAGGAGG + Intronic
1113966389 13:114155772-114155794 GGGGAGGGGTGGGGTGCAGAGGG + Intergenic
1114611327 14:24042922-24042944 AGGCTGGGGAGGGGAGCAGACGG - Intergenic
1114616500 14:24071503-24071525 TGGATGGGGAGGGGTGGGGGGGG - Intronic
1114626895 14:24136135-24136157 GGGGCGGGGAGGGCTGGAGGAGG - Intergenic
1115180678 14:30622293-30622315 CGGCTGGGGAGCGGAGCGGGGGG - Exonic
1115344831 14:32331374-32331396 AGGGTGGGGAAGGGCGCTGGTGG + Intronic
1115389817 14:32842036-32842058 GGGGAGGGGAGGGGAGGAGGGGG - Intergenic
1115566459 14:34629625-34629647 CACGCGGGGCGGGGTGCAGGTGG - Intronic
1115888816 14:38004306-38004328 GGGGTGGGGTGGGGTGTTGGAGG + Intronic
1117955948 14:61123794-61123816 CTGGTGGGGAGGGCTGGGGGAGG - Intergenic
1118096756 14:62546150-62546172 GGGGTGGGGAGGGGGGAGGGGGG - Intergenic
1118146101 14:63139149-63139171 GGTGGGGGGAGGGGGGCAGGGGG - Intergenic
1118663147 14:68037143-68037165 GGGGAGGGGAGGGGGGGAGGGGG - Intronic
1118734153 14:68690187-68690209 GGGGTAGGGAGAGGTGCTGGGGG + Intronic
1119731878 14:76956451-76956473 GGGGAGGGGAGGGGAGCAAGAGG - Intergenic
1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG + Intronic
1121006935 14:90496462-90496484 GGGGTGTGGAGGGGAGCAGAAGG - Intergenic
1121104384 14:91271076-91271098 GGGGGGTGGAGGGGCGCAGGGGG + Intergenic
1121104393 14:91271094-91271116 GGGGGGTGGAGGGGCGCAGGGGG + Intergenic
1121615511 14:95311200-95311222 CGGGTGGGGAGGGGGCTCGGAGG - Intronic
1121689407 14:95865431-95865453 CGGGTGGGGGGGGGGGTGGGGGG - Intergenic
1122137961 14:99645483-99645505 CGGGCGGGGCGGGGCGCGGGAGG + Intronic
1122140351 14:99659793-99659815 CAGGTGGGGTGGGGTGGGGGCGG - Intronic
1122178242 14:99936766-99936788 CAGGTTGGGAGGGGAGGAGGAGG - Intronic
1122293795 14:100693865-100693887 CTGGGGGAGAGGGGAGCAGGGGG - Intergenic
1122415080 14:101545578-101545600 GGAGTGGGGTGGGGTGGAGGGGG - Intergenic
1122419208 14:101564598-101564620 GGGTTGGGTAGGGGTGCAGAGGG + Intergenic
1122601893 14:102925624-102925646 CGGCAGGGGAGGGGAGTAGGGGG - Intronic
1122602294 14:102927924-102927946 CTGGCGGCCAGGGGTGCAGGAGG - Intronic
1122734909 14:103832733-103832755 AAGGGGGGGCGGGGTGCAGGGGG + Intronic
1122803156 14:104242736-104242758 GGGGAGGGGAGGGGAGCAGAGGG - Intergenic
1122842251 14:104471856-104471878 GGAGTGGGGACTGGTGCAGGTGG - Intergenic
1122842269 14:104472012-104472034 GGAATGGGGATGGGTGCAGGTGG - Intergenic
1122859439 14:104575980-104576002 CGGGTGGGGAGGGAGGTGGGAGG - Intronic
1122885337 14:104708056-104708078 CTGCTGGGGAGAGGGGCAGGTGG + Intronic
1122912306 14:104836838-104836860 GGGGGGGGGGGGGGTGCCGGAGG - Intergenic
1123054214 14:105561596-105561618 CGGGTGGGGAGGGGCCGTGGAGG + Intergenic
1123078798 14:105682015-105682037 CGGGTGGGGAGGGGCCGTGGAGG + Intergenic
1202902878 14_GL000194v1_random:53317-53339 CTGGTGGGGAAGTGGGCAGGGGG + Intergenic
1123435004 15:20248080-20248102 GGGGAGGGGAGGGGAGCAGAGGG + Intergenic
1123987654 15:25659337-25659359 CGGGTGGGGAGGCCTCCAGAGGG - Intergenic
1124109507 15:26773086-26773108 CGGAGGGGGAGGGGAGGAGGGGG + Intronic
1124239864 15:28020117-28020139 GGGGTGGGGATGGGTGGGGGCGG - Intronic
1124327315 15:28777973-28777995 TGGGTGGGGTGGGGTGTAGATGG + Intergenic
1124340460 15:28886516-28886538 CGGGCGGGGCGGGGACCAGGCGG + Intronic
1124529324 15:30489921-30489943 TGGGTGGGGTGGGGTGTAGATGG + Intergenic
1124769334 15:32517768-32517790 TGGGTGGGGTGGGGTGTAGATGG - Intergenic
1124930444 15:34114601-34114623 CGGGTGGGGCGGGCAGTAGGTGG - Intergenic
1125398474 15:39275155-39275177 GGGCTGGGGAGAGGGGCAGGAGG - Intergenic
1125570564 15:40714154-40714176 CTGAGGGGGAGGGGTGGAGGAGG + Intronic
1125686661 15:41567560-41567582 CGGGTGGGCAGGGCTGGAGCCGG + Intronic
1125728943 15:41882246-41882268 GTAGTGGGGAGGGGTGGAGGCGG - Intronic
1125894859 15:43293724-43293746 CGGGTGGTGGGGCGTGCGGGGGG + Intronic
1126688442 15:51267930-51267952 AGGGTGGGGAGGGGCGAAGGCGG - Intronic
1127322051 15:57856430-57856452 GGGGTGTGGTGGGGTGGAGGAGG + Intergenic
1127362731 15:58259321-58259343 GGGGTGGGGAGGGGTAGGGGAGG + Intronic
1127657795 15:61071650-61071672 GGGGTGGGGAGGGGTGGGGAGGG + Intronic
1127657801 15:61071660-61071682 GGGGTGGGGAGGGGAGAGGGGGG + Intronic
1127691664 15:61403009-61403031 GGGCTGGGGAGGGGTGGGGGAGG - Intergenic
1128214418 15:65924369-65924391 TGGGTGGGGGGGGGGGCAAGTGG + Intronic
1128389442 15:67173253-67173275 GGGGCGGGGAGGGGGGCAGCTGG + Intronic
1128494618 15:68187845-68187867 GGGGTGGGGATGGGAGCAGCAGG - Exonic
1128513069 15:68325557-68325579 TGGGTGGGGTGGGATACAGGCGG - Intronic
1128567574 15:68711410-68711432 GGGGTGTGCTGGGGTGCAGGAGG - Intronic
1128582230 15:68818346-68818368 GCGGCGGGGAGGGGCGCAGGGGG + Intronic
1128714418 15:69896959-69896981 AGGGTGGGGAGTGGAGGAGGAGG - Intergenic
1128987365 15:72231099-72231121 CCGGAGGTGAGCGGTGCAGGAGG - Exonic
1129192095 15:73943139-73943161 CAGGAGGGGAGGGGAGCAAGCGG + Intronic
1129208000 15:74048581-74048603 CGGGGGGGGGGGGGGGGAGGGGG - Intergenic
1129379123 15:75154471-75154493 GGGGAGGGGAGGGGTGGAGACGG - Intergenic
1129424583 15:75454556-75454578 CGGGCGGGGAGGGGCGCGGGGGG - Intronic
1129596429 15:76967803-76967825 GGGGTGGGGAGGGGGTGAGGAGG - Intergenic
1129644415 15:77417459-77417481 CGGGGGGGGAGGGGGGCAAGAGG + Intronic
1129669311 15:77598381-77598403 AGGGTGGAGATGGGGGCAGGGGG - Intergenic
1129683660 15:77672262-77672284 AGGGAGGGGAGGGGTGAAAGGGG - Intronic
1129847695 15:78775543-78775565 CGGGGGGGTGGGGGTGCAGGGGG - Intronic
1130301099 15:82680363-82680385 CGGGTGGGCAGAGGTGGAAGCGG + Intronic
1130321972 15:82849124-82849146 CTGGGGGGGCGGGGGGCAGGGGG + Exonic
1130531093 15:84748464-84748486 TGGGGGGGGGGGGGGGCAGGCGG - Intergenic
1130553276 15:84905459-84905481 CGGGTGGGGGTGAGAGCAGGGGG - Intronic
1130899854 15:88199105-88199127 AGGGTGGGGTGGGGAGAAGGAGG + Intronic
1131071637 15:89470037-89470059 GGGGTGCGAAGGGGTGCTGGGGG - Intergenic
1131091746 15:89629145-89629167 AGGGTGGTGAGGGCTGCAGGCGG + Intronic
1131165870 15:90141891-90141913 CGGGTGGGGAGTGGAGCCCGTGG + Intergenic
1131232605 15:90670579-90670601 CTGGAGGGGTGGGGAGCAGGGGG + Intergenic
1131263677 15:90903152-90903174 CGGGTGGGGAGGGAGCCGGGCGG + Exonic
1131285145 15:91050710-91050732 GGGGTGGGGTGGGGTGCGGTGGG + Intergenic
1131701823 15:94945080-94945102 CGGGTGATGAGGGTTGCAGAAGG - Intergenic
1131770237 15:95729251-95729273 TGGGTGGGGTGGGGTGGTGGTGG - Intergenic
1131832867 15:96365579-96365601 GGGGTGGGGGCGGGGGCAGGGGG - Intergenic
1132411185 15:101579289-101579311 GAAGTGGGGAGGGGGGCAGGGGG - Intergenic
1132514576 16:360181-360203 CAGGTGGGCGGGGGCGCAGGTGG - Intergenic
1132537459 16:489757-489779 TGGGTGGAGGGCGGTGCAGGAGG + Intronic
1132540192 16:504847-504869 CAGGAGGTGAGGGGTGCAGGAGG - Intronic
1132581284 16:685839-685861 GGGGTGGGTAGGGGTGCTGATGG - Intronic
1132595254 16:746211-746233 CGGGTCTGCAGGGCTGCAGGAGG + Intronic
1132595299 16:746386-746408 CGGGTCTGCAGGGCTGCAGGAGG + Intronic
1132599668 16:767969-767991 CGTGTGGGGGGGCGTGGAGGGGG + Intronic
1132651461 16:1023086-1023108 TGGGTGGGGCGGGGGGCACGGGG + Intergenic
1132654852 16:1037442-1037464 CGTGGGGGGTGGGGTGGAGGGGG + Intergenic
1132711962 16:1272811-1272833 TGGCTGGGCAGGGCTGCAGGTGG + Intergenic
1132747187 16:1441686-1441708 TGTGTGGGGAGGGGTGGAGGCGG + Intronic
1132767359 16:1541272-1541294 CAGGAGGTGAGGGGGGCAGGTGG + Intronic
1132773986 16:1581739-1581761 GGGGAGGGGAGGGGAGCGGGGGG + Intronic
1132805136 16:1771785-1771807 CGGGGGGGGCGGGGTTCGGGCGG - Intergenic
1132978350 16:2721399-2721421 CGGGCGGCCAGGGGTGCAGAAGG + Intergenic
1132991665 16:2798697-2798719 CGGCTGGGCCGGGGTGCACGGGG + Intergenic
1133023580 16:2977722-2977744 CGGGGGGAGAGGGGTGCTGGAGG - Intronic
1133058411 16:3158802-3158824 CGGGCGGGGAGGGGTAGGGGTGG + Intergenic
1133061105 16:3175121-3175143 GGGGTGGGCTGGGTTGCAGGGGG - Intergenic
1133140626 16:3741148-3741170 TGGGTGAGGAGGGGTGGCGGCGG - Intronic
1133285919 16:4690776-4690798 CGGGGGGCGGGCGGTGCAGGGGG - Exonic
1133344451 16:5060514-5060536 CCAGTGGGCAGGGCTGCAGGAGG - Intronic
1133722808 16:8510738-8510760 AGAGTGGGGAGGGATGGAGGGGG - Intergenic
1133748825 16:8708451-8708473 GGGGTGGTGGGGGGCGCAGGTGG + Intronic
1133781500 16:8942440-8942462 AGGCTGGGGTGAGGTGCAGGTGG - Intronic
1134005901 16:10818652-10818674 CGGGTGGGGCGGGGCGCTCGGGG + Exonic
1134869488 16:17638834-17638856 GGGGAGGGGAGGGTTGCCGGAGG + Intergenic
1135142251 16:19931837-19931859 CATGTGGGGAGGGGTACAGCAGG + Intergenic
1135552342 16:23408126-23408148 CGAGTGGGGCGGGAGGCAGGGGG + Intronic
1135552392 16:23408264-23408286 CGAGTGGGGCGGGAGGCAGGGGG + Intronic
1135628171 16:24014273-24014295 GGGGTGGGGAGGGGAGGAGATGG + Intronic
1136008143 16:27345085-27345107 GGGGTGGGCAGGGGAGGAGGTGG + Intronic
1136109198 16:28054105-28054127 CGGGGGAGGAGGGGAGGAGGAGG - Intronic
1136171626 16:28493407-28493429 GGGCTGGGGAGGGGAGAAGGAGG + Intronic
1136248101 16:28986450-28986472 AGTGTGGGGAAGGGTTCAGGCGG + Intronic
1136267865 16:29131500-29131522 AGGACGGGGAGGGGTGCAGGAGG + Intergenic
1136281186 16:29212359-29212381 AGAGTGGGGAGGGGAGCTGGGGG + Intergenic
1136366481 16:29811512-29811534 CGCGTGGGGAGGGATGCGGCTGG - Intronic
1136580457 16:31148398-31148420 CGGCTGGGGAGACGTCCAGGAGG - Exonic
1136605163 16:31329081-31329103 GAGATGGGGTGGGGTGCAGGGGG - Intronic
1137534263 16:49305739-49305761 GGGGAGGGGAGGGGGGAAGGGGG - Intergenic
1137592368 16:49701477-49701499 GGGGAGGGGAGGGGAGCAAGTGG + Intronic
1137675644 16:50302549-50302571 AGGGTGGGGTGGGGGGAAGGTGG - Intronic
1137723143 16:50639536-50639558 CCGGTGGGGCAGGGGGCAGGTGG - Exonic
1137751023 16:50861217-50861239 TGGGTGGGGATGGGTGGAGAAGG - Intergenic
1137758911 16:50924958-50924980 CAGGTGGGGAGTGGGGGAGGGGG - Intergenic
1138144246 16:54594943-54594965 GGGGTGGGGAGGGGGGGAGGTGG - Intergenic
1138550957 16:57748244-57748266 GGGGTGTGGAGGGGGGCCGGAGG - Intronic
1138766535 16:59612267-59612289 CTGCTGGGGCGGGGTGGAGGGGG - Intergenic
1138862555 16:60775394-60775416 CGGGAGGGGAGGGGAGGATGAGG + Intergenic
1139136056 16:64206175-64206197 GGGGTGGGGTGGGGTGAAGTGGG + Intergenic
1139140375 16:64255067-64255089 GGGGAGGGGAGGGGTGGAGAGGG + Intergenic
1139140385 16:64255087-64255109 GGGGAGGGGAGGGGTGGAGAGGG + Intergenic
1139349364 16:66325652-66325674 GGGGTGGGGAGGGGGGCTGTGGG - Intergenic
1139392528 16:66613969-66613991 CGGGTGGGTTGGGGTGAGGGTGG + Intergenic
1139468033 16:67164565-67164587 GGGGTGGGGTGGGGTGGAGTGGG - Exonic
1139529127 16:67533665-67533687 AGGGTGGGAAGAGGAGCAGGCGG + Intronic
1139548169 16:67659497-67659519 GGGGTGGGGAGAGCTGCTGGAGG + Intronic
1139548694 16:67661675-67661697 GGGGTGAGGAGGGGTACAGTGGG + Exonic
1139636943 16:68263868-68263890 AGGGAGGGGAAGGGGGCAGGAGG + Intergenic
1139754407 16:69131813-69131835 CGAGTGGGGTGGGGTCCTGGAGG - Intronic
1139912787 16:70408406-70408428 GGGGTGGGGGTGGGCGCAGGTGG + Intronic
1139952715 16:70679934-70679956 CGGGCGGGCAGGGGGGCGGGGGG - Intronic
1139953193 16:70681689-70681711 CAGGAGGGGAGGGGAGCAGGGGG - Intronic
1140121012 16:72082945-72082967 CGGGAAGGAAGGGGTGCTGGAGG - Intronic
1140866600 16:79067621-79067643 TGGGTGGGGTGGGGGGCGGGGGG + Intronic
1140892247 16:79295087-79295109 GGGGTGGGGGAGGGGGCAGGGGG + Intergenic
1140928089 16:79601322-79601344 CGGGAAGGGAGGGATGCAGTGGG + Intergenic
1141181215 16:81754346-81754368 GGGGAGGGGAGGGGAGGAGGTGG - Intronic
1141181237 16:81754388-81754410 GGGGAGGGGAGGGGAGGAGGTGG - Intronic
1141524772 16:84604242-84604264 AGTGTGGGGTGGGGAGCAGGGGG - Intronic
1141594620 16:85089645-85089667 CGGGAGGGGAGGATGGCAGGAGG - Exonic
1141683097 16:85555394-85555416 AGGGGGGGGAGGGGTGTTGGTGG + Intergenic
1141809255 16:86363834-86363856 TGGGTGGGGTGGGGTGGGGGTGG - Intergenic
1141839695 16:86566947-86566969 CGCGCGAGGAGGGGCGCAGGAGG - Intergenic
1141855386 16:86677717-86677739 GGAGAGGGGAGGGGGGCAGGGGG - Intergenic
1141877292 16:86834631-86834653 ATGGTGGAGAGGGCTGCAGGGGG - Intergenic
1142071169 16:88091847-88091869 AGGACGGGGAGGGGTGCAGGAGG + Intronic
1142085549 16:88178282-88178304 AGAGTGGGGAGGGGAGCTGGGGG + Intergenic
1142105507 16:88300264-88300286 CGGGTGGTGAGGGTGGGAGGTGG + Intergenic
1142291083 16:89193844-89193866 GGGGTGGCTGGGGGTGCAGGCGG - Exonic
1142291675 16:89196085-89196107 GGAGTGGGGAGCGGCGCAGGCGG + Exonic
1142481921 17:224304-224326 CAGGTGGCGTGGGATGCAGGAGG - Intronic
1142489027 17:266045-266067 TGGGTGGGGAGAGGGGCAGGAGG - Intronic
1142549927 17:732388-732410 CGGGTGGGCGGGGGCGGAGGCGG - Intergenic
1142715509 17:1745078-1745100 AAGGTGGGGTGGGGTGGAGGGGG + Intronic
1142743787 17:1945005-1945027 CGGCTGGGGAGGGAAGGAGGGGG - Intronic
1142762148 17:2049045-2049067 CGGGTGGGGAGTGAAGGAGGGGG + Intergenic
1142765220 17:2060636-2060658 CGGGCAAGGAGGGGTGAAGGGGG + Exonic
1142836843 17:2593837-2593859 GGGGAGGGGAGGGGAGCGGGCGG - Exonic
1142848676 17:2694091-2694113 CAGGTGGGGCTGGGTGGAGGTGG - Intronic
1143426698 17:6845173-6845195 AGGGTGGGGAGGCGTGCAATGGG - Intergenic
1143564822 17:7715106-7715128 TGGGTGGGGGGAGGTGAAGGGGG + Intergenic
1143590870 17:7885291-7885313 CGGCGGGGGAGGGGTGCGGCGGG - Intronic
1143704589 17:8687679-8687701 GGGGAGGAGAGGGGTGGAGGGGG - Intergenic
1143778802 17:9218630-9218652 GGGGTGGGGGGCGGGGCAGGAGG - Intronic
1143803877 17:9409078-9409100 CTGGTGGGGGCGGGGGCAGGGGG - Intronic
1143822099 17:9573072-9573094 GGGGTGGGGGGGGGTGTTGGGGG - Intronic
1144163169 17:12581639-12581661 GGGGTGGGGAGGGGCACAGGTGG - Intergenic
1144220169 17:13092587-13092609 AGAGTGGGGTGGGGTGCAGCTGG + Intergenic
1144243374 17:13336160-13336182 GGGGTAGGGGTGGGTGCAGGTGG - Intergenic
1144440655 17:15278343-15278365 AAGGTGGGGTGGGGGGCAGGCGG - Intergenic
1144572359 17:16407789-16407811 CGGGGGATGAGGGGTGGAGGAGG + Intergenic
1144573752 17:16416337-16416359 AGGGTGGAGAAGGGGGCAGGGGG - Intronic
1144729384 17:17517892-17517914 CTGGGTGGGTGGGGTGCAGGCGG - Intronic
1144736993 17:17560833-17560855 AGGGTGGGGTGAGGTGGAGGTGG - Intronic
1144787654 17:17840765-17840787 CAGGGGGGCAGGGGGGCAGGGGG - Intergenic
1144832762 17:18140663-18140685 GAGGTGGGGTGGGGGGCAGGTGG + Exonic
1144851176 17:18244719-18244741 CGGCGGGGGGGGGGGGCAGGGGG + Exonic
1145839736 17:27984622-27984644 GGGGGGGGGGGGGGTGCGGGGGG - Intergenic
1145977903 17:28994804-28994826 CGGATGGGCAGGGGTAGAGGAGG + Intronic
1146062465 17:29614404-29614426 CTGGTGGGAAGGGGTGGGGGTGG - Exonic
1146306376 17:31732876-31732898 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
1146658343 17:34648547-34648569 GGGATGGGGAGGGGAGGAGGTGG - Intergenic
1147119154 17:38325453-38325475 TGGGCGGGGAGGGGTGGGGGAGG + Intergenic
1147188775 17:38726810-38726832 TGGTGGGGGTGGGGTGCAGGAGG - Exonic
1147257996 17:39193621-39193643 GTGGTGGGGAGTGGTGGAGGGGG - Intronic
1147313461 17:39607751-39607773 GGGGAGGGGAGGGGGGGAGGGGG + Exonic
1147323756 17:39660659-39660681 AGGGTCGGGAGGAGGGCAGGAGG + Intronic
1147592829 17:41695911-41695933 CGTGTGGGGATGGGGGCAGGAGG - Intergenic
1147608238 17:41786147-41786169 CGCGTGGGGTGGGGTGAGGGTGG + Intronic
1147768316 17:42851416-42851438 CTGGTGGGCAGGGGTGGAGATGG + Exonic
1147896552 17:43755316-43755338 CCGGTGGGGAGGGGCGCGGGCGG + Exonic
1148052927 17:44778020-44778042 TGGGTGGGGACGTGGGCAGGGGG - Exonic
1148159830 17:45443615-45443637 AGGGTGGGGATGGGTGAATGGGG + Intronic
1148382814 17:47211876-47211898 GGGGTGGGGTGGGGTGCATAAGG + Intronic
1148555690 17:48577553-48577575 AAGTTGGGGAGGGGTGGAGGAGG - Intronic
1148863226 17:50615295-50615317 TGGGGGTGGAGGGGTGCGGGGGG + Intronic
1148876486 17:50690337-50690359 CGGGAGGGGAGGGGGGGCGGTGG + Intronic
1148987877 17:51639303-51639325 GCGGTGGGGAGGAGTGAAGGGGG + Intronic
1149607277 17:57933937-57933959 AGGATGGGGAGGGGAGCAGGAGG - Intronic
1150479187 17:65496596-65496618 GGGGGTGGGAGGGGCGCAGGAGG + Intergenic
1150725158 17:67645575-67645597 TGGGGGAGGAGGGATGCAGGGGG + Intronic
1151084203 17:71362538-71362560 AGGGAGTGGAGGGATGCAGGTGG - Intergenic
1151197913 17:72445250-72445272 TGGGTGGGGCGGGGAGGAGGAGG - Intergenic
1151353127 17:73543219-73543241 GGGCTGGGGAGGGGAGGAGGAGG + Intronic
1151387642 17:73764771-73764793 CGGGTGGGCAGGGGTGGGTGGGG + Intergenic
1151418694 17:73983623-73983645 CGGGTGGGGGGTGGTGGTGGGGG - Intergenic
1151511923 17:74566021-74566043 CGGGGGGGCAGGGGGGCGGGCGG + Intergenic
1151550901 17:74821942-74821964 AGGCTGGGGAGAGGTGGAGGGGG + Intronic
1151554606 17:74840420-74840442 GGGGGGGGGGGGGGGGCAGGAGG - Intergenic
1151570569 17:74923532-74923554 GAGCTGGGGAGGGGTGCCGGAGG + Intergenic
1152196811 17:78923392-78923414 GGGGTGGGGGGGGGGGCGGGAGG + Intronic
1152234632 17:79132273-79132295 GGGGTGGGGTGGGGGGCAGAGGG + Intronic
1152253119 17:79221915-79221937 CAGATGGGGAGGGGTGCAGAGGG + Intronic
1152279466 17:79376743-79376765 CAGGTGGGGAGGCTCGCAGGGGG + Intronic
1152301043 17:79495486-79495508 AGGTGGGGGAGGGGTGCAGAGGG + Intronic
1152301056 17:79495514-79495536 AGGTGGGGGAGGGGTGCAGAGGG + Intronic
1152336119 17:79701058-79701080 GGGGAGAGGAGGGATGCAGGTGG + Intergenic
1152430695 17:80246911-80246933 AGGGTAGGGATGGGGGCAGGGGG - Intronic
1152512846 17:80802049-80802071 CGGATTGGTAGGGGTGGAGGAGG + Intronic
1152589482 17:81204347-81204369 CTGCTGGGGAGGGGTGGCGGTGG - Intronic
1152602359 17:81270850-81270872 GGGCTGGGGAGAGGTGGAGGCGG - Intronic
1152642356 17:81454536-81454558 TGGGTGGGGTGGGGTGGGGGCGG - Intronic
1152643531 17:81458772-81458794 AGGCTTGGGTGGGGTGCAGGCGG - Intronic
1152677715 17:81650366-81650388 GGGGTGGGCAGTGGGGCAGGAGG - Intergenic
1152716231 17:81902140-81902162 CGGGCGGGCTGGGGTGCAGCGGG - Exonic
1152762802 17:82118209-82118231 GGAGTCTGGAGGGGTGCAGGGGG + Intronic
1152853082 17:82648796-82648818 CGGGCGGGGCGGGGCGGAGGCGG + Intergenic
1153173219 18:2339992-2340014 CGGGTGGGGATCAGAGCAGGAGG - Intergenic
1153328064 18:3842116-3842138 TGGGGGGTGAGGGGTGGAGGGGG + Intronic
1153560695 18:6369344-6369366 CGGGCAGGGAGGGATGCTGGGGG + Intronic
1154066332 18:11110597-11110619 GTGGTGGGCAGGGGAGCAGGTGG + Intronic
1154128786 18:11717257-11717279 CGGGGAGGGAGAGGTGCCGGGGG - Intronic
1154202577 18:12309178-12309200 CGGGGCGGGAGGGGGGCGGGGGG - Intronic
1154385485 18:13888332-13888354 CTGGTGGTGGGGGCTGCAGGTGG + Intronic
1154502302 18:15002943-15002965 TGGGGGGGCAGGGCTGCAGGCGG + Intergenic
1154980229 18:21497793-21497815 GGGGTGGTGAGGGGAGAAGGAGG - Intronic
1155041067 18:22066075-22066097 TAGGTGGGGTGGGGTGGAGGAGG - Intergenic
1155507926 18:26549523-26549545 CGGGTGGGGAAGGGTCCCTGTGG - Intronic
1155547579 18:26930935-26930957 GGGGTGGGGTGGGGTGGGGGAGG + Intronic
1156079526 18:33316453-33316475 TGTGGGGGGAGGGGTGCGGGGGG - Intronic
1156231183 18:35155408-35155430 CGGATGGGGGTGGGTGGAGGAGG + Intergenic
1156476395 18:37408493-37408515 GGGGGGGGGCGCGGTGCAGGAGG + Intronic
1157110557 18:44816409-44816431 CTGAGGGGAAGGGGTGCAGGAGG + Intronic
1157239685 18:45997652-45997674 GGGGGGGGGAGGGGAGGAGGGGG - Intronic
1157285414 18:46374081-46374103 CTGGTGGGGAGGGGAGGTGGGGG - Intronic
1157562022 18:48654969-48654991 TGTGTGGGGTGGGGGGCAGGGGG + Intronic
1157568193 18:48694300-48694322 CAGGTGAGGAGGGCTGCAGGAGG + Intronic
1157697224 18:49732584-49732606 TGGGTGGGCAGGAATGCAGGAGG - Intergenic
1157901469 18:51522453-51522475 CGGTTGGTGGGGGGTGGAGGGGG + Intergenic
1158319649 18:56248884-56248906 TGGGGGTGGAGGGGGGCAGGGGG + Intergenic
1158452626 18:57580733-57580755 CCCGTGGGGTGGGGTGCAGTGGG - Intronic
1158931574 18:62328683-62328705 CGGATGGGATGGGGGGCAGGAGG - Intronic
1158940746 18:62404337-62404359 CGGGGAGGGCGGGGTCCAGGGGG + Intergenic
1158960417 18:62583671-62583693 GGGGTGGGGTTGGGTGGAGGGGG - Intronic
1159117996 18:64136970-64136992 GATTTGGGGAGGGGTGCAGGTGG - Intergenic
1159991174 18:74910394-74910416 AGGGTGGGGTGGGGAGCTGGAGG - Intronic
1160026781 18:75224749-75224771 GTGGTGGGGAGGGGTGCGGCGGG + Intronic
1160051971 18:75442198-75442220 TGGGTGGGGATGGGCCCAGGAGG + Intergenic
1160073703 18:75651491-75651513 AGGTTGGGGGGTGGTGCAGGTGG - Intergenic
1160107892 18:75995091-75995113 CTGGTTGGGAGGGGGCCAGGAGG + Intergenic
1160158254 18:76450339-76450361 AGGGTGGGGAGTGGGGGAGGGGG - Intronic
1160208738 18:76858935-76858957 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160208753 18:76858979-76859001 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160208809 18:76859155-76859177 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160208836 18:76859243-76859265 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160238167 18:77102123-77102145 TGGGTGGGGAGAGGTGGAGAAGG + Intronic
1160500938 18:79400825-79400847 CGGGTGGGGGGGGGGTCGGGGGG - Intronic
1160505634 18:79425364-79425386 CGGCTGAGGAGGGCTGCGGGAGG + Intronic
1160511278 18:79454866-79454888 AAGGTGGGGAGGGGTGTGGGTGG - Intronic
1160540729 18:79620782-79620804 CGTGTGTGGAGGTGGGCAGGGGG + Intergenic
1160586842 18:79917822-79917844 GGTGTGGTGTGGGGTGCAGGTGG - Intronic
1160596721 18:79980601-79980623 AGGGTGGGGAGAGGGGGAGGGGG + Intronic
1160714653 19:570708-570730 TGGGTTGGGAGGGGCGGAGGGGG + Intergenic
1160714665 19:570731-570753 TGGGTTGGGAGGGGCGGAGGGGG + Intergenic
1160714677 19:570754-570776 TGGGTTGGGAGGGGCGGAGGGGG + Intergenic
1160714689 19:570777-570799 TGGGTTGGGAGGGGCGGAGGGGG + Intergenic
1160715697 19:575605-575627 TGGGTGGGGAGGAGGGCGGGTGG + Intronic
1160728651 19:630356-630378 CGGGTGGGGAGGTGCGGAGGTGG - Intronic
1160763640 19:797757-797779 CGGAGGGGGAGGGGCGCGGGAGG - Intronic
1160798674 19:957109-957131 TGGGTGGGGGGGGGCGCTGGGGG + Intronic
1160847629 19:1173497-1173519 CGGGAGGGGCGGGGAGCAAGGGG + Intronic
1160868272 19:1265709-1265731 GGGGTGGGGCGGGGTGGCGGGGG + Intronic
1160960461 19:1718565-1718587 GGGCGGAGGAGGGGTGCAGGGGG + Intergenic
1161004113 19:1925912-1925934 CGGCGGGGGAGGGGTGGGGGGGG - Exonic
1161041845 19:2114624-2114646 AGGCTGGGGTGGGGTGCGGGCGG - Intronic
1161044506 19:2128105-2128127 GGGAAGGGGAGGGGTGCAGTGGG - Intronic
1161129829 19:2581307-2581329 CGGGGGTGGAGGGGTGATGGGGG + Intronic
1161201828 19:3019411-3019433 CGGGGGGTGAGGGGCACAGGGGG + Exonic
1161224337 19:3136210-3136232 AGGGTGGGGACGGGAGGAGGTGG - Exonic
1161323769 19:3653248-3653270 CGGGGAGGGAGGGTGGCAGGTGG - Intronic
1161494960 19:4581578-4581600 CGGCTGGGGAGGGGGGCTGGGGG + Intergenic
1161521218 19:4724371-4724393 GGGGTGGGGCGGGGTGGGGGGGG + Intronic
1161522040 19:4730104-4730126 CCGCTGGGGAGGGGTGTGGGTGG - Intergenic
1161575041 19:5050445-5050467 CGGGGGGGCCGGAGTGCAGGTGG + Intronic
1161645046 19:5448050-5448072 CGGGTGGAGAGGTGTGGAGAGGG - Intergenic
1161702310 19:5802329-5802351 GGGGCGGGGCGGGGCGCAGGAGG - Intergenic
1161767621 19:6216098-6216120 CTGGCAGGGAGGGGTGCAGGAGG - Intronic
1161776328 19:6264237-6264259 GGGGTGGGGAGGGGTGGAGGGGG - Intronic
1161964294 19:7539891-7539913 TGGGAGGGGAGGGGTGCCGGGGG - Intronic
1161977201 19:7613212-7613234 CGGGTGGGGGCGGGGGGAGGTGG + Intronic
1161978662 19:7619554-7619576 GGGGTGGGGAGGGGGGATGGGGG + Exonic
1162007285 19:7788680-7788702 CGGGATGGGAGGGGGGCCGGAGG + Intergenic
1162034447 19:7931651-7931673 AGGGAGGGGTGGGCTGCAGGGGG + Intronic
1162594008 19:11613130-11613152 AGGGAGGGGAGGGGGGAAGGAGG - Intronic
1162788837 19:13052774-13052796 TGTGTGTGGACGGGTGCAGGGGG - Intronic
1162818194 19:13208531-13208553 CGGGTGGGCAAGGGGGCTGGGGG + Intronic
1162821924 19:13228325-13228347 TGGGAGGTGAGGGGTGGAGGGGG + Intronic
1162850833 19:13429990-13430012 GGAGTGGGGAGGGGGGAAGGGGG + Intronic
1162907234 19:13831163-13831185 CGGCTGGAGATGGGGGCAGGGGG + Exonic
1163154766 19:15433635-15433657 AGGATGGCTAGGGGTGCAGGAGG - Intronic
1163167410 19:15507892-15507914 TGGGTGGGGAGGAGTGGCGGAGG + Intergenic
1163390424 19:17027048-17027070 CTGGTGGGGAGGGGGGCATCCGG - Intergenic
1163442914 19:17330557-17330579 AGGATAGGGAGGGGTGCAGAAGG - Intronic
1163502730 19:17686368-17686390 GGGGTGGGGCGGGATGCTGGGGG + Intronic
1163566135 19:18052286-18052308 GAGGTGGGGAGGGGAGGAGGGGG + Intergenic
1163755520 19:19104326-19104348 TGGGTGGTGAGGGGTGAGGGAGG + Intronic
1164599533 19:29551453-29551475 ATGGTGGGGTGGGGGGCAGGGGG + Intronic
1164612614 19:29643076-29643098 TTGGTGGTGGGGGGTGCAGGGGG + Intergenic
1164909361 19:31993004-31993026 AGGGAGGGGAGGGGAGCAGTGGG - Intergenic
1164914302 19:32038075-32038097 CGGGGCAGGAGGGGGGCAGGAGG + Intergenic
1165078380 19:33293619-33293641 GGGGTGGGGATGGGTCAAGGGGG - Intergenic
1165094565 19:33403130-33403152 AGGGGGCGGAGGGGCGCAGGTGG + Intronic
1165290320 19:34878764-34878786 CAGGTGAGGAGGGATCCAGGGGG - Intergenic
1165412422 19:35670357-35670379 AGGGAGGGGAGGGGAGCAGGGGG - Intronic
1165420654 19:35720584-35720606 GGGGGTGGGAGGGGTGGAGGAGG - Exonic
1165487145 19:36102926-36102948 CCTGTGGGGAGGAGAGCAGGGGG - Exonic
1165490708 19:36121296-36121318 CCTGTAGTGAGGGGTGCAGGCGG + Intronic
1165559809 19:36669177-36669199 TTGGTGGGGAGGGGTCCTGGAGG + Intergenic
1165735698 19:38174081-38174103 AGGCTGGGGAAGGATGCAGGAGG + Intronic
1165811636 19:38615218-38615240 GGGGTGGGGTGGAGTGGAGGGGG + Intronic
1165829579 19:38723853-38723875 GGGGTGGGGAGGGGTCCAGAGGG - Intronic
1166046178 19:40232460-40232482 AGGGTGGGGAGGGGTGGGGTTGG - Exonic
1166084863 19:40467623-40467645 CGGGGGGGGGGGGGTGTTGGGGG + Intronic
1166101993 19:40576544-40576566 GGGGTGGGGAGAGGGGCACGGGG + Intergenic
1166250485 19:41565968-41565990 CGGGGGGGGTGGGGTTCTGGAGG + Intronic
1166326530 19:42054290-42054312 CGAGCGGGGATGGGTGGAGGAGG - Intronic
1166380146 19:42351409-42351431 CGCCTGGGGTGGGGAGCAGGGGG - Exonic
1166667472 19:44689622-44689644 GGAGTGGGGAGGAGTCCAGGCGG - Intergenic
1166671174 19:44710398-44710420 GGGGTGGGCAGGGGAGCAGAAGG + Intronic
1166674806 19:44733636-44733658 GGGATGGGGAGGGGTGCAGAGGG - Intergenic
1166809415 19:45506852-45506874 GGGGTGGGGTGGGGTGGAGGTGG - Intronic
1166921448 19:46231528-46231550 CAGGTGGGGTGGGGAGGAGGTGG + Intergenic
1166960308 19:46492968-46492990 CGGTTGGGAAGGGGAGGAGGAGG - Exonic
1167019650 19:46863654-46863676 CTGGGGGGGAGGGGCGAAGGCGG - Intergenic
1167110305 19:47456897-47456919 CGGGGTGGGGGGTGTGCAGGGGG - Intronic
1167216878 19:48170802-48170824 CGGGCGGGGAGGGGGGGAGTAGG + Intronic
1167244462 19:48365159-48365181 CGTGTGGGGAGGGCTGCCAGGGG - Intronic
1167337905 19:48897801-48897823 CAGATGGGTAGGGGTGGAGGTGG - Intronic
1167364322 19:49046954-49046976 GGGGGTGGGAGGGGTGGAGGAGG + Intergenic
1167368016 19:49064873-49064895 CGGGTGGGGAGGGACGGGGGCGG - Intronic
1167561289 19:50227444-50227466 CGGGGGACGGGGGGTGCAGGCGG - Intronic
1167593909 19:50417727-50417749 CGGGTGGGCTGGGCAGCAGGCGG + Intronic
1167716277 19:51144542-51144564 GGGTGGTGGAGGGGTGCAGGGGG - Exonic
1167721088 19:51181225-51181247 CGGGTGGGTGGGGGTGTGGGTGG + Intergenic
1168141715 19:54392472-54392494 TGGGTGGTGGGGGGTGGAGGCGG + Intergenic
1168147614 19:54428861-54428883 CGGGTGGGGAGGGGTGCAGGGGG - Intronic
1168286964 19:55340042-55340064 CGGGCGGGGTGGGGGGCAGTCGG - Intronic
1168296634 19:55380288-55380310 GGGGAGGGGAGGGGGGAAGGGGG - Intronic
1168296694 19:55380395-55380417 GGGGAGGGGAGGGGAGGAGGGGG - Intronic
1168336672 19:55600822-55600844 AGGGGAGGGGGGGGTGCAGGGGG + Intronic
1168347032 19:55654945-55654967 GGGGCGGGGAGGGCTGCCGGAGG + Intronic
1168354419 19:55692555-55692577 CGGGTGGGGTGGGTTTCTGGGGG + Intronic
1168713442 19:58514360-58514382 GGGGTGGGGTGGGGTGGGGGCGG - Intronic
1168713560 19:58514750-58514772 CGGGTGGGTAGGGGTTGAGGGGG - Intronic
1202683838 1_KI270712v1_random:31285-31307 CGGGGGGGGAGGGGTGGGGGAGG - Intergenic
925028057 2:625144-625166 AGGCTGGGGAAGGGAGCAGGGGG - Intergenic
925208510 2:2027034-2027056 GAGGTGGCGAGGGGTCCAGGTGG - Intronic
925336011 2:3099806-3099828 CTGGTGGAGTGGGGAGCAGGTGG - Intergenic
925420227 2:3704549-3704571 CGGGTGTGGAGGAGGGCATGGGG + Intronic
925755378 2:7128064-7128086 GGGGAGGGGAGGGGAGGAGGGGG - Intergenic
925893756 2:8456391-8456413 TGGGTGGGGTGGGGTGGCGGTGG - Intergenic
926010027 2:9400237-9400259 CAGGAGGGGAAGGGGGCAGGAGG - Intronic
926036784 2:9641945-9641967 GGGGTGGGGGGGTGTGCAGGAGG + Intergenic
926084663 2:10012936-10012958 CAGGTGGGCAGGTGTGCATGTGG + Intergenic
926084690 2:10013052-10013074 CAGGTGGGCAGGGGTGCATATGG + Intergenic
926094612 2:10073120-10073142 CTGGGGGGCAGCGGTGCAGGTGG + Intronic
926095868 2:10080302-10080324 CGGCCGGGGCGGGCTGCAGGGGG + Exonic
926135509 2:10332959-10332981 CTTGGGGTGAGGGGTGCAGGGGG + Intronic
926226576 2:10971220-10971242 AGGGTGGGGTTGGGTGCTGGGGG + Intergenic
926703162 2:15817668-15817690 AGGGTGGGGTGGGGTGAAGAGGG - Intergenic
926707087 2:15844606-15844628 TGGGTGGGGTGGGGCGGAGGGGG - Intergenic
927154938 2:20216053-20216075 GAGGTGGGGAGGGAGGCAGGGGG + Intronic
927413713 2:22855154-22855176 GTGGTGGGGTGGGGGGCAGGTGG + Intergenic
927637252 2:24825335-24825357 GGGGGGGGGGGGGGTGCGGGGGG + Intronic
927812075 2:26185790-26185812 CTTGTAGGGAGGGATGCAGGTGG + Intronic
927843770 2:26461070-26461092 GGGGTGGGGCGGGGTGGGGGTGG + Intronic
927865676 2:26585854-26585876 GGGCTGGGGAGGGGAGCATGAGG - Intronic
928032870 2:27796648-27796670 GGGGGTGGGAGGGGTGCCGGTGG + Intronic
928549731 2:32358066-32358088 GGGGTGGGGAGGGAAGTAGGCGG + Intronic
928949353 2:36800627-36800649 AGGGTGTGGAGGCGTGCAGGAGG - Intronic
929151235 2:38750923-38750945 CGGGGGGGGAGGGGGGCCGGCGG + Intronic
929449630 2:42028055-42028077 GGGGTGGGGATGGGAGCTGGAGG + Intergenic
929579083 2:43070400-43070422 CTGGTGGGGCTGGGTGGAGGTGG - Intergenic
929711347 2:44270163-44270185 TGGGTGGGGAGTGGGGCTGGGGG - Intergenic
929863654 2:45699926-45699948 GGGGAGCTGAGGGGTGCAGGGGG + Intronic
930651729 2:53970798-53970820 CGGGTGGGAGGGGGTGGGGGGGG - Exonic
930700923 2:54456986-54457008 CGGGTGGGGAGCGGGGGCGGCGG + Intronic
930798604 2:55419692-55419714 CGGGAGGGGAAGGGGGCTGGAGG - Intronic
931006115 2:57850927-57850949 GGGGAGGAGTGGGGTGCAGGTGG - Intergenic
931197246 2:60064332-60064354 GCAGTGGGGAGGGGTGGAGGAGG + Intergenic
931839361 2:66132186-66132208 ATGGTGGGGAGGGGTGGAGTAGG + Intergenic
931904809 2:66831004-66831026 CTGCTGGGGAGGGGTAAAGGAGG + Intergenic
931924325 2:67054813-67054835 AGCATGGGGAGGGGTGAAGGGGG - Intergenic
932491938 2:72127990-72128012 AGGGTGGGGAAAGGGGCAGGGGG - Intergenic
932567271 2:72917824-72917846 GGGGAGGTGAGGGGTGCGGGCGG + Exonic
932687383 2:73883525-73883547 GGAGTGGGGAGGGGTGAAGAGGG + Intergenic
932805321 2:74778185-74778207 GGTGTGGGGAGTGGGGCAGGGGG + Intergenic
933005528 2:76988744-76988766 GGGGTGGGTGGGGGTGGAGGAGG - Intronic
933164694 2:79063268-79063290 TGTGTGGGGAGGGGTGTTGGGGG + Intergenic
933695720 2:85215763-85215785 GGGGTGGGGGGGGGTGAGGGGGG + Intronic
933727480 2:85435013-85435035 GGGGTGGGGTGGGGTGGGGGTGG - Exonic
933789960 2:85875926-85875948 CCTGTGGGGAGGGGAGCAGGCGG - Intronic
934515119 2:94981507-94981529 AGGATGACGAGGGGTGCAGGTGG + Intergenic
934557119 2:95293368-95293390 CGGATGAGGAGGGATGGAGGGGG + Intergenic
934646741 2:96063367-96063389 CAGCTGGGGAGGGGTGCATGGGG + Intergenic
934712966 2:96527653-96527675 GGGGTGGGGAGGGGGGAGGGCGG - Intergenic
934757232 2:96832696-96832718 CTGGAGGGGATGGGGGCAGGCGG - Exonic
934840144 2:97619449-97619471 CAGCTGGGGAGGGGCGCATGGGG + Intergenic
934893368 2:98089512-98089534 GGGGTGGGGTGGGGAGAAGGGGG + Intronic
935005778 2:99074882-99074904 CGGGTGGCGAGGGTTGCAGTGGG + Intronic
935164999 2:100562740-100562762 GGGGTGGGGCTGGGTGGAGGAGG - Exonic
935313560 2:101808536-101808558 GGGGTGGGGGGGGGTGAGGGTGG - Intronic
935360922 2:102245666-102245688 CCCGTGGGGAGGGGTGGCGGTGG + Intergenic
936118309 2:109720184-109720206 AGGGCGTGGAGGCGTGCAGGAGG - Intergenic
936234626 2:110732527-110732549 CGGGCCGGGAGGGGTGGAGAGGG + Intergenic
936242080 2:110796551-110796573 GGGGTGGGGAAGGGAGCAGAAGG - Intronic
936463073 2:112725828-112725850 AGGGTGGGGTCAGGTGCAGGAGG - Intronic
936520741 2:113210594-113210616 TGGGTGGGGAAGGGGGCAGTGGG - Intergenic
936780887 2:116030774-116030796 AGGGAGGGGAGGGAGGCAGGGGG - Intergenic
936860472 2:117012239-117012261 GTGGTGGGGAGGGGGGAAGGGGG - Intergenic
936974255 2:118203567-118203589 GAGGTGGGGTGGTGTGCAGGGGG - Intergenic
937027613 2:118712306-118712328 GGGGAGGGGAGGGGAGGAGGTGG + Intergenic
937093913 2:119223792-119223814 CGGGTGGGGCGCGGGGGAGGAGG + Intergenic
937260209 2:120580723-120580745 CCAGTGGGAAGGGGTCCAGGAGG - Intergenic
937291633 2:120785476-120785498 GGTGTGGGGAGGGCTGCAGCTGG + Intronic
937298293 2:120823072-120823094 CGGGTGGCGGGGGGTGCAGGGGG - Intronic
937314578 2:120922860-120922882 CAGGTAGGCAGGGCTGCAGGTGG - Intronic
937319274 2:120951326-120951348 CGGGTGGGGGGCGTTGAAGGGGG - Exonic
937969473 2:127538099-127538121 GGGGTGGGAAGGGATGCAGCAGG + Intronic
937983570 2:127628560-127628582 GGGGTGGGGTGGGGTGGGGGAGG + Intronic
937998908 2:127716473-127716495 CTGTTGGGGAGAGTTGCAGGGGG - Intronic
938081639 2:128373434-128373456 GGGGTGGGGTGGGGTGGGGGGGG - Intergenic
938091393 2:128437073-128437095 GGGGTGTGGAGGGGTGAGGGTGG + Intergenic
938538450 2:132265413-132265435 GGGGTGGGGTGGGGTGGGGGCGG + Intergenic
938697250 2:133845397-133845419 GAGGTGGGGAGGGCTGCAGCAGG - Intergenic
939529903 2:143345459-143345481 GGGTTGGGGTGGGGTTCAGGTGG - Intronic
939630261 2:144520461-144520483 CGGGGAGGGGGGGGTGGAGGGGG - Intronic
940033488 2:149289101-149289123 GGGGTGGGGTGGGGTGGTGGGGG + Intergenic
940160783 2:150711135-150711157 TGGGGGTGGAGGGGTGGAGGTGG + Intergenic
940431941 2:153602416-153602438 TTGGTGGGTAGGGGGGCAGGTGG + Intergenic
940750821 2:157625599-157625621 GGGGTGCAGAGGGGTGCAGGGGG + Intronic
940767051 2:157800888-157800910 GGGTTGGAGAGGGGTGGAGGAGG - Intronic
940866183 2:158819787-158819809 GGGGTGGGGTGGGGTGGGGGTGG - Intronic
940883311 2:158968495-158968517 GGGGCGGGGAGGGGCGCGGGAGG + Intergenic
941185617 2:162318497-162318519 CAGGTGGGCAGGCGGGCAGGTGG + Exonic
941653774 2:168121643-168121665 TAGGTGGGGTGGGGTGCAGATGG - Intronic
941846018 2:170133906-170133928 GGGGTGGTGGGGGGAGCAGGAGG + Intergenic
942049285 2:172123848-172123870 CTGCTGGGGAGGGGGGCCGGGGG - Intergenic
942135100 2:172917496-172917518 GGGTTGGGGAGGGGTGCAGGGGG + Intronic
942175260 2:173327510-173327532 GGGGTGGGGAGGGATTCAAGGGG - Intergenic
942209039 2:173652276-173652298 GGTGTGGGGAGGAATGCAGGGGG - Intergenic
942505202 2:176634553-176634575 GGGGTGGGGATGGTTGAAGGGGG + Intergenic
942664899 2:178307137-178307159 CAGGGGGTGAGGGGTGGAGGGGG - Intronic
943798268 2:192026071-192026093 AGGGTGGGGAGGGGCGCACAGGG - Intronic
944451685 2:199850676-199850698 CGGGTGGGGAGGCGCGGGGGCGG - Intronic
944507221 2:200425122-200425144 CGGGGGGGGGGGGGGGCGGGGGG - Intronic
945080921 2:206085654-206085676 CGGGCGGGCAGGGGTCCAGCCGG - Intronic
945261522 2:207848213-207848235 GGGGTGGGGATGGAGGCAGGTGG - Intronic
945649356 2:212539010-212539032 CGGGAGGGGAGCGGGGCGGGGGG + Intergenic
945913909 2:215682477-215682499 CGGGTGGGAAGTTGAGCAGGAGG + Intergenic
946088567 2:217198863-217198885 GGGGTGGAGAGAGGGGCAGGGGG - Intergenic
946194289 2:218023891-218023913 CAGCTGGGGAAGGGTGTAGGGGG - Intergenic
946227603 2:218272544-218272566 CGGGTGGGGAGATGTGCACGGGG - Intronic
946321289 2:218955900-218955922 AGGGTGGGGGGGGGGGCAGCAGG + Intergenic
946402912 2:219477838-219477860 AGGGTTGGGAGGGGTGGAGAGGG + Intronic
946879390 2:224162025-224162047 AGGCTGGGAAGGGGTGCAGGAGG - Intergenic
947351686 2:229252889-229252911 TGGGTGGGGAAGGGGGTAGGGGG + Intronic
947353995 2:229273254-229273276 TAGGTGTGGAGGTGTGCAGGAGG - Intergenic
947514004 2:230785372-230785394 CGCGTGGGCAGGGGGGCAGGGGG + Intronic
947514009 2:230785380-230785402 CAGGGGGGCAGGGGGGCAGGGGG + Intronic
947520066 2:230838719-230838741 TGTGTAGGGAGGGGTTCAGGAGG - Intergenic
947666767 2:231910900-231910922 TGGGTGGGGAGGGGCAGAGGCGG - Intergenic
947742670 2:232491770-232491792 GTGGAGAGGAGGGGTGCAGGAGG - Intergenic
947787717 2:232838803-232838825 GGGTGGGGGAGGGGTGCAGAGGG - Intronic
947942998 2:234075401-234075423 AGGGCGGTGACGGGTGCAGGAGG - Intronic
947984381 2:234436504-234436526 CTGGTGGGGAGGGATGCTGAGGG + Intergenic
948284747 2:236774699-236774721 GGGGTGGTGAGGGGTGGAGTGGG + Intergenic
948294116 2:236848074-236848096 AGGAGGGGGAGGGGTGTAGGAGG + Intergenic
948409695 2:237749559-237749581 CGGGTGCTGAGGGGCGCAGGGGG - Intronic
948511280 2:238466814-238466836 AGGGTAGGGAGGTGTGCTGGAGG + Intergenic
948571915 2:238923011-238923033 CAGGTGGGGAGGGAAGCAGGTGG - Intergenic
948578523 2:238969230-238969252 GGTGCAGGGAGGGGTGCAGGAGG - Intergenic
948588255 2:239034798-239034820 GGGGTGGGGAGCAGGGCAGGAGG - Intergenic
948693869 2:239722948-239722970 GGGGTGGGGAGGGGCGCTGAAGG + Intergenic
948809424 2:240467149-240467171 TGGGTGAGGATGGGAGCAGGCGG - Exonic
948847519 2:240690257-240690279 GGGTTGGGGAGGGGGACAGGCGG + Intergenic
948848138 2:240692746-240692768 CGACTGGGGAGAGGTGCAGTGGG - Intronic
948864770 2:240769615-240769637 CGGATGGAGAGGTGTGCAGCGGG - Exonic
948947217 2:241226901-241226923 TGGGTGGTGGGGGGTGCGGGCGG - Intergenic
949005162 2:241641819-241641841 CGGGTGTGGAGAGGTCCAGGAGG + Intronic
1168757619 20:327309-327331 AGGGAAGGGAGGGGCGCAGGAGG - Exonic
1168760776 20:348080-348102 CAGGTGAGGAGGTGTGGAGGGGG - Intronic
1168830244 20:841642-841664 CTAGTGGGGAGGGGGCCAGGTGG + Intronic
1168954783 20:1827327-1827349 CGGGTGGGGAGGGGAGGAAAAGG + Intergenic
1169208443 20:3752866-3752888 TGGCTGGGGTGGGGTGCAAGTGG - Exonic
1169348059 20:4844859-4844881 GGGGAGGGGAGGGGGGGAGGGGG + Intergenic
1169522878 20:6391959-6391981 GGGGTGGGGAGGAGTGGAAGGGG + Intergenic
1169998927 20:11593132-11593154 TGAGTGGGGTGGGGTGGAGGGGG - Intergenic
1170578475 20:17681542-17681564 CCGGAGGGGTGGGGTGCGGGCGG - Intronic
1170578691 20:17682281-17682303 CGGGTGGGGAAGGCAGGAGGCGG - Exonic
1170817063 20:19722330-19722352 CAGGAAGGGAGGGGTGCAGCTGG - Exonic
1171022880 20:21602701-21602723 TGGGTAGGGAGGGCTGGAGGTGG + Intergenic
1171257126 20:23697880-23697902 ATGGTGAGGAGGGGAGCAGGAGG + Intergenic
1171494880 20:25548680-25548702 CGGGTGGGGCTGGGTGTGGGAGG - Intronic
1171970031 20:31558594-31558616 AGGCTGGGCAGGGGTGAAGGAGG - Intronic
1172255011 20:33509965-33509987 GTGGTGGGGTGGGGGGCAGGGGG - Intronic
1172284661 20:33732180-33732202 CGGGGCGGGAGGGGCGCGGGCGG + Intronic
1172443407 20:34980742-34980764 CGGTTGGGGAGGAGTCCAGGCGG - Intronic
1172497504 20:35398759-35398781 GGGGGGGGGGGCGGTGCAGGGGG + Intronic
1172608933 20:36234962-36234984 GGAGTGGGGAGGGGTGGAGAGGG + Intergenic
1172661768 20:36573545-36573567 CGGGTGGGGGAGGGCGCAGAGGG + Exonic
1172840787 20:37901878-37901900 CGGGTGGGGCGGGGGGCGGGGGG + Intergenic
1172846267 20:37931517-37931539 CGGCGGGGGATGGGTGGAGGGGG - Intronic
1172879124 20:38187023-38187045 AGGGGGAGGAGGGGTGGAGGAGG + Intergenic
1173162790 20:40664525-40664547 GGGGTTGGGAGGGGGGGAGGCGG + Intergenic
1173460959 20:43243118-43243140 ACAGTGGGGAGGGGAGCAGGGGG + Intergenic
1173548177 20:43914900-43914922 CGGGCGCCGAGGGGTACAGGCGG - Exonic
1173577635 20:44123357-44123379 CCCATGGGAAGGGGTGCAGGAGG - Intronic
1173749868 20:45468776-45468798 CAGGTGGGAAGTGGTGGAGGTGG + Intergenic
1173826239 20:46049486-46049508 TGGGTGGTGAGGGGTATAGGTGG + Intronic
1173908087 20:46643188-46643210 TGGGTGGGAAGGGGGGAAGGGGG + Intronic
1174028423 20:47599384-47599406 GGGGTGGGAATGGGAGCAGGGGG + Intronic
1174177397 20:48653606-48653628 TGGGGTGGGAGGGGTGGAGGTGG - Intronic
1174284830 20:49465117-49465139 GGGGTGGGGAGGGGAACAAGAGG + Intronic
1174295643 20:49543324-49543346 GGGGTGGAGAGGGAGGCAGGAGG - Intronic
1174298964 20:49568348-49568370 AGGGAGGGGAGGGGAGAAGGAGG + Intergenic
1174327663 20:49792114-49792136 GGGAAGGTGAGGGGTGCAGGAGG + Intergenic
1174397889 20:50259171-50259193 TGGGGTGGGAGGGGTGCAGTAGG - Intergenic
1174410074 20:50329644-50329666 AGGAAGGGGAGGGGAGCAGGGGG - Intergenic
1174601573 20:51729326-51729348 GAGGTGGGGTGGGGTGGAGGGGG - Intronic
1174677774 20:52374890-52374912 CTGGTGGGGAGTGGGGCAGTTGG + Intergenic
1174855203 20:54038141-54038163 CTAGTGGTGAGGGCTGCAGGTGG - Intronic
1175199389 20:57267118-57267140 TGAGTGGGGAGAGGTCCAGGCGG - Intergenic
1175361883 20:58418479-58418501 GGGGTGGGGTGGGGTGGGGGTGG - Intronic
1175407678 20:58745433-58745455 CTGGTGGGGTGGGGAGCAGCAGG + Intergenic
1175599138 20:60258494-60258516 AGGGTGGGGAGGAGAGAAGGTGG + Intergenic
1175831769 20:61968568-61968590 GGGCTGGGGAAGGGCGCAGGTGG - Intronic
1175921174 20:62451251-62451273 GGGCTGGGGTGGGGAGCAGGTGG - Intergenic
1175973072 20:62696866-62696888 GGGGTGGGGTGGGGTGTGGGTGG + Intergenic
1175984810 20:62759322-62759344 CTGCTGGGGAGGTGTGGAGGGGG + Intronic
1176020518 20:62960378-62960400 CGGGTGGGGAGGTGAGCTAGAGG + Intronic
1176026087 20:62986349-62986371 CAGGTGGACTGGGGTGCAGGTGG + Intergenic
1176026106 20:62986414-62986436 CAGGTGGTCAGTGGTGCAGGTGG + Intergenic
1176026162 20:62986605-62986627 CAGGTGGGCGGGGGTGCGGGTGG + Intergenic
1176026170 20:62986621-62986643 CGGGTGGGCGGGGGTGTGGGTGG + Intergenic
1176026184 20:62986671-62986693 CGGGTGGACTAGGGTGCAGGTGG + Intergenic
1176026189 20:62986687-62986709 CAGGTGGGCAGGGGTGCAGTTGG + Intergenic
1176075736 20:63247532-63247554 CGGGTGGGGATGGGTTGATGGGG - Intronic
1176115199 20:63429153-63429175 GGAGTGGGGAGGGGTGAAGAGGG - Intronic
1176131825 20:63499485-63499507 AGGCGGGGGAGGGGAGCAGGTGG + Intergenic
1176138763 20:63536146-63536168 CAGGTGGGGGGGGGAGCGGGAGG - Intronic
1176256933 20:64157927-64157949 CAGGTGGGGACAGGGGCAGGTGG - Intronic
1176256950 20:64157969-64157991 CAGGTGGGGACGGGGACAGGTGG - Intronic
1176256993 20:64158081-64158103 CAGGTGGGGACAGGGGCAGGTGG - Intronic
1176257082 20:64158351-64158373 CAGGTGGGGACAGGGGCAGGTGG - Intronic
1176293590 21:5059090-5059112 CAGATGGGGATGGCTGCAGGGGG - Intergenic
1176414644 21:6467638-6467660 CGGGCTGGGTGGGGTGGAGGAGG - Intergenic
1176427477 21:6557690-6557712 CGTGTGGTGAGGGGCGCAAGAGG + Intergenic
1176548892 21:8213213-8213235 CGGAAGGGGAAGGGTGCCGGCGG + Intergenic
1176556787 21:8257426-8257448 CGGAAGGGGAAGGGTGCCGGCGG + Intergenic
1176567823 21:8396248-8396270 CGGAAGGGGAAGGGTGCCGGCGG + Intergenic
1176575726 21:8440467-8440489 CGGAAGGGGAAGGGTGCCGGCGG + Intergenic
1176622242 21:9068084-9068106 CTGGTGGGGAAGTGGGCAGGGGG + Intergenic
1176887474 21:14273845-14273867 CGCCTGGGGCGGGGTGCTGGTGG - Intergenic
1176973251 21:15290008-15290030 TGGGTGGGTCGGGGTGGAGGCGG + Intergenic
1177167692 21:17621350-17621372 GGGGTGGGGACGGGGGAAGGAGG + Intergenic
1178278169 21:31257896-31257918 TGGCTGGGGTGGGGTGGAGGTGG - Intronic
1178916476 21:36708088-36708110 CGGGGAGGTTGGGGTGCAGGCGG + Intronic
1179067738 21:38041864-38041886 CGGGTGGTGAGCGGTGCTAGGGG - Intronic
1179134467 21:38667567-38667589 GAGGTGGGAAGGGGTGCCGGAGG - Intergenic
1179209349 21:39312944-39312966 CGGGGGGGGCGGGGGGCGGGGGG + Intronic
1179232644 21:39519155-39519177 CAGTTGGGGAGGGGCTCAGGTGG + Intergenic
1179437018 21:41369181-41369203 TGGGAGGAGGGGGGTGCAGGAGG + Intronic
1179551549 21:42146759-42146781 CTGGGGAGGAGGGGTGCAGTGGG + Intergenic
1179551566 21:42146813-42146835 CTGGGGAGGAGGGGTGCAGTGGG + Intergenic
1179608070 21:42531109-42531131 GGGGTGGGGAGGGCTGGATGTGG + Intronic
1179639780 21:42739478-42739500 CTGGCGGGGAGGTCTGCAGGAGG - Intronic
1179647520 21:42784716-42784738 GGGGTGGGGTGGGGTAAAGGTGG - Intergenic
1179675098 21:42975273-42975295 CGGGTGGGTCGGGGTCCTGGGGG + Intronic
1179690144 21:43075960-43075982 CGGGCTGGGTGGGGTGGAGGAGG - Intronic
1179702968 21:43166007-43166029 CGTGTGGTGAGGGGCGCAAGAGG + Intergenic
1179804079 21:43826178-43826200 AGGATGGGGAGGGGTGGAGACGG - Intergenic
1179863670 21:44204558-44204580 CAGATGGGGATGGCTGCAGGGGG + Intergenic
1179897186 21:44369518-44369540 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179897204 21:44369576-44369598 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179897222 21:44369636-44369658 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179897256 21:44369754-44369776 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179897274 21:44369814-44369836 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179897292 21:44369874-44369896 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179897310 21:44369932-44369954 CGGGTGCTGCGGGGAGCAGGTGG + Intronic
1179901591 21:44396909-44396931 GGGGTGTGGAGGGGTGTGGGGGG + Intronic
1179955730 21:44737178-44737200 GGGGTGGGGTGGAGGGCAGGGGG + Intergenic
1179970817 21:44836087-44836109 CGGGTGGGGTGGGGTGGGGTGGG - Intergenic
1179983785 21:44910254-44910276 CAGGTGGGGAGGGGTCCAGGAGG + Intronic
1179990817 21:44947458-44947480 TGGGGGAGGAGGGGTGCAGATGG - Intronic
1180027811 21:45178311-45178333 AGCCTGGGGAGGGGTGCAGGTGG + Intronic
1180092316 21:45539426-45539448 CGGCTTGGGAGGGTGGCAGGGGG + Intronic
1180094463 21:45549656-45549678 GTGGTGGGGAGGGGGACAGGTGG + Intergenic
1180312890 22:11253533-11253555 CGGGCGGGGAGGGGGGCACAGGG + Intergenic
1180642857 22:17313336-17313358 GGTGTGCAGAGGGGTGCAGGAGG + Intergenic
1180783536 22:18534814-18534836 TGGGAGGAGATGGGTGCAGGGGG - Intergenic
1180867444 22:19127484-19127506 CGGGTGGGAGGGGCTGCAGGAGG + Intergenic
1180950143 22:19717180-19717202 CGGGTGGGGTGGGGTGGGGTTGG + Intronic
1180967313 22:19797344-19797366 AGGGGGGGTGGGGGTGCAGGCGG + Intronic
1181027516 22:20134423-20134445 TGGGTAGGCAGGGGTCCAGGCGG + Intronic
1181031240 22:20149689-20149711 CTGAGGGGGAGGGGTGCTGGGGG - Intronic
1181127103 22:20708865-20708887 TGGGAGGAGATGGGTGCAGGGGG - Intronic
1181162638 22:20967204-20967226 AGGGAGGGCAGGGGTCCAGGAGG - Intronic
1181240438 22:21474166-21474188 TGGGAGGAGATGGGTGCAGGGGG - Intergenic
1181418574 22:22779739-22779761 TGGAGGGGGAGGGGTGGAGGAGG + Intronic
1181470743 22:23137780-23137802 GGGGTGGGGACGGGGGCTGGTGG + Intronic
1181492303 22:23268232-23268254 TGCGTGGGGAGGGGAGCAGGTGG + Intronic
1181512098 22:23393708-23393730 CTGAGGGGGAGGGGTGCTGGGGG + Intergenic
1181552034 22:23645362-23645384 CAGGTGGGGAGGGAAGGAGGGGG - Intergenic
1181572232 22:23773824-23773846 CGGGCAGGGAAGGGAGCAGGAGG + Intronic
1181586790 22:23857073-23857095 TGGGGGGGGGGGGGTGTAGGTGG + Intronic
1182254755 22:29030603-29030625 CCGGTGGGGAGGGGCGCGGCCGG + Intronic
1182709185 22:32310050-32310072 GGGGTGGGGAGGGGGGAGGGAGG + Intergenic
1182921045 22:34079542-34079564 TGGAAGGGTAGGGGTGCAGGAGG + Intergenic
1183291469 22:37004276-37004298 CTGGTGGGGTGGGGTGGGGGTGG - Intronic
1183322520 22:37173755-37173777 GGGTTGGGGAGGGGTCCTGGAGG + Intronic
1183483254 22:38076160-38076182 CGTGTGGGGAGAGGTGCTCGGGG + Intergenic
1183564197 22:38601441-38601463 GGGGTGGGGGCGGGTGCAGAGGG + Intronic
1183704647 22:39469203-39469225 TGGGTGGGGAGGGGCCCAGAAGG + Intronic
1184099818 22:42336180-42336202 CTGTTGGGGAGGGGTGGTGGTGG + Intronic
1184101566 22:42343923-42343945 CGGCGGGGGAGGGGCGCGGGCGG + Intergenic
1184109302 22:42385584-42385606 AGGGTGGGGAGGGAGGGAGGGGG - Intronic
1184164983 22:42721712-42721734 CGGGTGGGTGGGGGAGCTGGTGG - Intergenic
1184236887 22:43187390-43187412 GCGGTGGGGAGGGGGGCAGGGGG - Intergenic
1184248512 22:43247689-43247711 TGGATGGGGAGGGCTGCAGGAGG + Intronic
1184250974 22:43260114-43260136 AGAGTGGGCAGGGGTGCAGCTGG + Intronic
1184337394 22:43862026-43862048 GGGGTGGGGTGGGGTGGGGGTGG - Intronic
1184423372 22:44394902-44394924 TGAGTGGGGAAGGGTGGAGGGGG + Intergenic
1184562156 22:45269398-45269420 CGGGAGGTGAGAAGTGCAGGGGG - Intergenic
1184571226 22:45326161-45326183 GGGGTGGGGGCGGGTTCAGGAGG - Intronic
1184595211 22:45509704-45509726 CAGGAGGGGCAGGGTGCAGGTGG + Intronic
1184673230 22:46026706-46026728 CAGGTGGGGAGGGGTGCCGCAGG + Intergenic
1184690846 22:46116644-46116666 AGGTGGGGGGGGGGTGCAGGCGG - Intergenic
1184753403 22:46502293-46502315 AGGGTGGGGAGGGGAGGAAGAGG + Intronic
1184792526 22:46708828-46708850 CGGGAAGAGAGGGTTGCAGGGGG + Intronic
1184836834 22:47028979-47029001 CAGCTGGGCAGAGGTGCAGGTGG - Intronic
1184892510 22:47388647-47388669 CGGGAGGAGAGGGATTCAGGAGG + Intergenic
1185189563 22:49426256-49426278 CGGGAGGCGGGGGGTGCAGGAGG - Intronic
1185271634 22:49932135-49932157 CGGGCGGGGGCGGGGGCAGGGGG + Intergenic
1185284040 22:49992262-49992284 CAGGTGGGGAGAAGTGCAGAAGG - Intergenic
1185285416 22:49997749-49997771 AGTGGGGTGAGGGGTGCAGGAGG + Intronic
1185313675 22:50170035-50170057 AGGGTGGGCAGGGGTGGGGGCGG - Intergenic
1185330299 22:50249266-50249288 GGGGAGGGGAGGGGCCCAGGGGG + Intronic
1185336813 22:50274665-50274687 GGGGCTGGGAGGGGTGCTGGGGG - Intergenic
1185336842 22:50274727-50274749 GGGGCTGGGAGGGGTGCTGGGGG - Intergenic
1185336857 22:50274759-50274781 GGGGCTGGGAGGGGTGCTGGGGG - Intergenic
1185336873 22:50274791-50274813 GGGGCTGGGAGGGGTGCTGGGGG - Intergenic
1185336902 22:50274853-50274875 GGGGCTGGGAGGGGTGCTGGGGG - Intergenic
1185421723 22:50738657-50738679 CTGGGGGGTAGGGGTGCAAGCGG - Intronic
1203253777 22_KI270733v1_random:129521-129543 CGGAAGGGGAAGGGTGCCGGCGG + Intergenic
1203261833 22_KI270733v1_random:174600-174622 CGGAAGGGGAAGGGTGCCGGCGG + Intergenic
949251612 3:1991635-1991657 CGGATGGTGAGTGGTGCAGCAGG - Intergenic
949483200 3:4513205-4513227 GTGGTGTGGAGGGGTGGAGGTGG - Intronic
949874751 3:8618835-8618857 TGGGTGGGGGGTGGTGCTGGAGG - Intergenic
950526719 3:13528744-13528766 GGGGTGGGGAGGGGGGAAAGGGG - Intergenic
950702804 3:14761728-14761750 GGAGTGGGGAGGGGGGCTGGAGG + Intronic
950902796 3:16512958-16512980 TGGGTGGGGCAGGGTGGAGGCGG - Intronic
950977278 3:17261470-17261492 GGGGTGGGGTGGGGTGGGGGGGG + Intronic
951080350 3:18444904-18444926 CGGGCGGGGGGGGGAGAAGGGGG + Intronic
951513198 3:23527814-23527836 GGGGTGGGGTGGGGTGGTGGGGG - Intronic
951630656 3:24716520-24716542 CCAGTGGGGAGGGGGGCGGGGGG + Intergenic
952252984 3:31672357-31672379 GGGGCGGGGGGGGGGGCAGGAGG + Intronic
952388782 3:32862071-32862093 TGGGGGAGGAGGGGAGCAGGTGG + Intronic
952389247 3:32865786-32865808 CGGGGGGGGGGGGGGGCCGGCGG - Intronic
952459010 3:33504665-33504687 CGGATGGGGAAGGGTGATGGGGG + Intronic
952767753 3:36969693-36969715 CGGGGGGGGGGGGGTGGAGGAGG + Intergenic
952867288 3:37862276-37862298 AAGGTGAGGAGGGGCGCAGGCGG + Exonic
952968762 3:38637512-38637534 AGAGTGGGGAGGAGAGCAGGAGG - Intronic
953119319 3:40024400-40024422 TGGGTGGTGGGAGGTGCAGGAGG + Intronic
953210100 3:40868150-40868172 GGGGTGGGGCTGGGTGGAGGTGG + Intergenic
953331053 3:42053371-42053393 CGGGTGGGGGGGGGGGGCGGGGG + Intronic
953578012 3:44128691-44128713 AGGGTGGTGAAGTGTGCAGGAGG + Intergenic
953888017 3:46729218-46729240 CTGGAGGGGAGGGGTGGGGGCGG - Intronic
954216342 3:49126505-49126527 CGAGTGGGGACAGGTGCAGTGGG + Intronic
954405862 3:50344796-50344818 GGGGTGGGGAGGGGTTGGGGAGG - Intronic
954410356 3:50367909-50367931 CAGGAGGGGAGGGGTGGGGGTGG + Exonic
954697292 3:52434708-52434730 GAGCTGGGGAAGGGTGCAGGCGG - Exonic
954707457 3:52488720-52488742 CGGGGGGGGCGAGGGGCAGGGGG - Intronic
954782193 3:53070073-53070095 TGGGTTGGGATGGGGGCAGGTGG - Intronic
954864680 3:53718557-53718579 GGGGTGGGGAGGTGTGCAGGAGG - Intronic
955128201 3:56136141-56136163 AGGGTGGGGTGAGGTGTAGGAGG - Intronic
955194263 3:56790549-56790571 AGGTTGGGGAGGGGTGGAAGTGG - Intronic
955426947 3:58801019-58801041 GGGGTGGGGTGGGGTGGGGGTGG + Intronic
956175792 3:66471881-66471903 CGGATGTGGAGGGGTAAAGGTGG - Intronic
956205163 3:66747955-66747977 GGGGTGGGAAGGGGTGGTGGAGG - Intergenic
956510239 3:69985452-69985474 AGGGTGGGGAGGGGTGATGGGGG + Intergenic
956678954 3:71760061-71760083 CGGATGTGGATGGGTGGAGGTGG - Intergenic
958438666 3:94129490-94129512 AGAGTGGGGAGGGGAGGAGGGGG + Intergenic
960286947 3:115840343-115840365 CGGGAGAGGGGGGGTGCGGGGGG - Intronic
960610618 3:119551909-119551931 CTGCTGGGTAGAGGTGCAGGAGG - Intronic
960871570 3:122254944-122254966 GGGGTGGGGAGGGTGGCAAGGGG - Intronic
961035977 3:123641821-123641843 GGGGAGGGGAGGGGAGAAGGAGG - Intronic
961117027 3:124339221-124339243 TGGGAGGGGACGGGTGCAGGTGG + Intronic
961455284 3:127020851-127020873 CGGTTTGGGAGGGGAGCATGTGG + Intronic
961532062 3:127546036-127546058 GGGGTGGGGAGTGGTGCGGGAGG - Intergenic
961873336 3:130003299-130003321 TGGCTGGGGCGGGGTGGAGGTGG - Intergenic
961907379 3:130276824-130276846 AGGGTGGGGTGGGGTGGGGGTGG - Intergenic
962212689 3:133492119-133492141 CAGCTGGGGTGGGGTGCTGGTGG - Intergenic
962323090 3:134407191-134407213 GGGGTGGGGTGGGGGGCAGTCGG + Intergenic
962332853 3:134494993-134495015 CGGGTGAGCAGGGGTGGAGGTGG - Intronic
962403397 3:135080331-135080353 AGAAGGGGGAGGGGTGCAGGAGG + Intronic
962750782 3:138433636-138433658 GGGGTGGGGAGGGGGGAGGGAGG + Intergenic
962826177 3:139102472-139102494 CGGGTGTGGGGATGTGCAGGAGG + Intronic
963026304 3:140922720-140922742 AGGGTGGGGAGGGCAGCAGCTGG - Intergenic
963252634 3:143117177-143117199 CTGGTGGGCAGGTGTGGAGGGGG + Intergenic
963411833 3:144938014-144938036 GGGGTGGGGTGGGGTGGAGTTGG + Intergenic
963543396 3:146623962-146623984 AGGGTGGGGATGGGTGGAGACGG + Intergenic
963942410 3:151108230-151108252 GGGGTGGGGTGAGGGGCAGGTGG + Intronic
964629486 3:158794693-158794715 CTGGTGGGGAGAGGTGGGGGTGG + Intronic
965321426 3:167256590-167256612 GGGGTGGGGTGGGGTGGAGGTGG - Intronic
965754951 3:172016248-172016270 ATGGTGGGGAGGGGGGCAGGGGG - Intergenic
965894846 3:173563007-173563029 CAGGTGGAGAAGGCTGCAGGTGG - Intronic
966711875 3:182980299-182980321 CGGGCGGGAAGGGGCGAAGGAGG + Intronic
966731879 3:183158472-183158494 GGGGTGGGGTGGGGTGGGGGTGG - Intronic
966754512 3:183355931-183355953 GGGGAGGGGAGGGGGGAAGGAGG - Intronic
966866558 3:184261586-184261608 CGGGCGGGGCGCGGTGGAGGCGG + Intronic
967274978 3:187765559-187765581 CAGGATGTGAGGGGTGCAGGAGG - Intergenic
967904007 3:194486526-194486548 CGGGTGGGCAGCGGCGCCGGGGG - Intronic
967994503 3:195156401-195156423 AGGGTGGGGAGGGGTCGTGGAGG + Intronic
968155161 3:196374887-196374909 GGGGAGGGGAGGGGGGGAGGGGG + Intronic
968188868 3:196653063-196653085 GGGGCGGGGAAGGGTGCTGGGGG + Intronic
968477825 4:820722-820744 AGGCTGGTGAGGGGTGCAGTTGG - Intronic
968479554 4:827141-827163 GGGGTGGGGAGGGGGGAGGGGGG + Intergenic
968498332 4:931588-931610 CAGGAGGTGAGCGGTGCAGGAGG - Intronic
968499871 4:944493-944515 AGGGAGGGGCGGGGAGCAGGTGG - Intronic
968505230 4:968278-968300 CGAGTGGTGCGGGGTCCAGGTGG - Exonic
968613844 4:1568682-1568704 CGGGTGGGGTGGGTGGGAGGCGG - Intergenic
968613855 4:1568707-1568729 CGGGTGGGGTGGGTGGGAGGCGG - Intergenic
968626271 4:1628019-1628041 TGGGTGGGGAGGGTGGCACGGGG + Intronic
968627628 4:1634328-1634350 CGGGTGTGGAGGGGTTGTGGGGG - Intronic
968647864 4:1749139-1749161 CAGGTGGGGAGGGGTCGTGGTGG - Intergenic
968658733 4:1789925-1789947 GAGGTGGGTGGGGGTGCAGGGGG + Intergenic
968724957 4:2242402-2242424 GGGGTGCAGAGGGGTGCAGAGGG + Intergenic
968739493 4:2320123-2320145 GGGGAGGGGAGGGGGACAGGAGG - Intronic
968817955 4:2831491-2831513 GGAGTGGGGAGGGGAGCAGAGGG + Intronic
968840293 4:2999247-2999269 TGGGTGGGGAGTGGTGGAAGGGG + Intronic
968872879 4:3250433-3250455 CGGGTGGGCAGGGGTCATGGTGG + Intronic
968920269 4:3518807-3518829 CAGGAGGGGTGGGGGGCAGGAGG + Intronic
968926575 4:3551561-3551583 CAGGAGGAGAGGTGTGCAGGGGG - Intergenic
969210773 4:5685528-5685550 GGGGTGTGGTGGGGTGCAGCCGG - Intronic
969262641 4:6043522-6043544 TGGGAGTGGAGGGGTGCAGGAGG - Intronic
969335059 4:6502930-6502952 GCAGAGGGGAGGGGTGCAGGTGG - Intronic
969350779 4:6596834-6596856 CAGGTGGGGTGGGGTGCTGAAGG - Intronic
969379390 4:6783613-6783635 CGGGGGAGGAGGGCCGCAGGCGG + Intronic
969490418 4:7496429-7496451 CGGGTGGGGAGTGGGGGGGGGGG - Intronic
969538488 4:7771046-7771068 CTGAGGAGGAGGGGTGCAGGGGG - Intronic
969613971 4:8241766-8241788 CGGAAGGGGAGGGGTACATGGGG - Intronic
969696513 4:8738135-8738157 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
969715960 4:8868253-8868275 CGGGCCGGGAGCGGTGCAGCGGG - Exonic
969866807 4:10081659-10081681 GGGGTGGGGGGGGGGGAAGGAGG + Intronic
970347505 4:15167750-15167772 GGGGTGGGATGGGGTGAAGGAGG + Intergenic
971244336 4:24914566-24914588 GGGGTGGGGGGGCGTGGAGGGGG - Intronic
971263317 4:25076528-25076550 CACGTGGGGCAGGGTGCAGGAGG - Intergenic
971325047 4:25636757-25636779 GGGGAGGGGAGGGCAGCAGGAGG - Intergenic
971374444 4:26045542-26045564 GGGGTGGGGAGGGCAGCAAGAGG - Intergenic
971422928 4:26490505-26490527 GAGGTGGGGCGGGGTGAAGGTGG - Intergenic
971432645 4:26584304-26584326 CGAGTGGGAAGGGATGCAGACGG + Intronic
971920779 4:32936747-32936769 GTGGTGGGGAGGGGGGGAGGGGG - Intergenic
972382908 4:38535978-38536000 TGGGTGGGGAGGGGAGGATGGGG - Intergenic
972418740 4:38867700-38867722 CTCGTGGGGCGGGGCGCAGGCGG + Intronic
972546791 4:40087664-40087686 CGGAGGGGGCGGGGTGCACGTGG - Intronic
972560196 4:40220264-40220286 GGGGTGGGGAGGGGGAGAGGAGG - Intronic
972632226 4:40852275-40852297 CGGGAGGCGAAGGCTGCAGGGGG + Intronic
972670615 4:41211383-41211405 GGGCGGGGGAGGGGAGCAGGTGG - Intronic
973027682 4:45293255-45293277 CTGGTGGGGAAGGGCGAAGGTGG + Intergenic
973619441 4:52712439-52712461 GGGGCGGGGAGGGAAGCAGGAGG - Intergenic
973719392 4:53707789-53707811 CGGCTGGGGAGGGGTGGGGTGGG + Intronic
973779153 4:54271992-54272014 GGGGAGGGGAGGGGGGGAGGGGG - Intronic
973840305 4:54854409-54854431 GGGGCGGTGATGGGTGCAGGAGG - Intergenic
974366393 4:60955149-60955171 GGGGTGTGGAGGGGTGCAGGAGG + Intergenic
974849267 4:67385613-67385635 GGGGAGGGGAGGGGGGAAGGAGG + Intergenic
975252149 4:72192866-72192888 GGGGTGGGGTGGGGTGGAGAGGG + Intergenic
975514239 4:75227335-75227357 TGTGTGGTGGGGGGTGCAGGGGG + Intergenic
976246484 4:83010836-83010858 CGGGCGGGGAGGGGAGGAGGAGG - Intronic
976258643 4:83124858-83124880 GGGGAGGGGAGGGGTGTGGGGGG + Intronic
977177971 4:93838793-93838815 GGGGAGGGGGGGGGTGCAAGGGG + Intergenic
977328023 4:95601909-95601931 CATGTTGGGAGGGGTGCATGGGG + Intergenic
977424634 4:96852004-96852026 AGGGTGGGGAGGGGGGCATTAGG + Intergenic
978585147 4:110269085-110269107 TGGGTGGGGTGGGGTGTGGGGGG + Intergenic
978710577 4:111775641-111775663 CAGGAGGGGAGGGGAGGAGGAGG + Intergenic
979099924 4:116600207-116600229 GGGATGGGGTGGGGTTCAGGGGG - Intergenic
979193397 4:117890860-117890882 GGGGTGGGGTGGGCGGCAGGGGG + Intergenic
980328418 4:131379349-131379371 CTGGCGGGGAGGTGTGGAGGAGG + Intergenic
980562983 4:134501956-134501978 CGGGGGGGAAGGGGGGCAGGCGG - Intergenic
980592874 4:134914541-134914563 CTGGTGGGCAGGGGTGGGGGTGG - Intergenic
980893570 4:138839723-138839745 CGGGGTGGGAGGGCGGCAGGAGG + Intergenic
981081131 4:140640443-140640465 GGGGTGGGGGGGGGAGTAGGTGG + Intronic
982035377 4:151341080-151341102 AGGGTGGGGAGGGGACCAGTGGG - Intergenic
982134389 4:152259434-152259456 AGGAAGGAGAGGGGTGCAGGTGG - Intergenic
983012530 4:162564848-162564870 GGGGTGGGGAGGGGAGGAGAGGG + Intergenic
983372423 4:166878203-166878225 CGGGTGGCGAAGGTTGCAGTGGG + Intronic
984303592 4:177956146-177956168 GGGGTGGGGTGGGGGGCAGGAGG + Intronic
985016223 4:185638656-185638678 GGGATGGGGAAGGGTGCGGGAGG + Intronic
985496189 5:207772-207794 GAGGTGTGGAGGGGTGGAGGTGG + Intronic
985505527 5:278071-278093 AAGGTGGGGAAGGGAGCAGGTGG - Intronic
985636081 5:1036504-1036526 TGGGTGGGGTGGGGTGGGGGGGG - Intronic
985706354 5:1403448-1403470 TGGGAGGGGAGGGGTGGAGAGGG - Intronic
985837289 5:2280668-2280690 CGAGTGGGCAGGGAGGCAGGTGG + Intergenic
985864042 5:2497857-2497879 CAAGTGGGGAGGGGGGCAGGTGG + Intergenic
985933190 5:3075422-3075444 TGGGTGGGGTGGGGTGGGGGTGG - Intergenic
986233556 5:5887165-5887187 GGGGTGGGAAGGGGTGGTGGTGG + Intergenic
986249337 5:6042513-6042535 TGGGTGGGGAGAGGGACAGGTGG + Intergenic
986325353 5:6668907-6668929 CGGGCAGGGAGGGGTGCTGGTGG + Exonic
987112462 5:14700675-14700697 AAGGTGGGGAGGGCTGCAGAGGG - Intergenic
988495546 5:31742528-31742550 GGGGTGGGGAGGGGGGGAGTTGG - Intronic
988592981 5:32565165-32565187 TGGGTGGGGATGGGGGCTGGAGG + Intronic
988712660 5:33794006-33794028 AGGGTGGGCAGAGGAGCAGGGGG - Intronic
988860189 5:35269308-35269330 AGATTGGGGAGGGGTGAAGGAGG - Intergenic
988923873 5:35969549-35969571 GGGGTGGGGAGGGGGACGGGTGG + Intronic
989011764 5:36878969-36878991 CGGGTGGGGGGGTGTGCGAGTGG + Intronic
989370876 5:40706325-40706347 TGAGTGGGGAGGGTGGCAGGGGG + Intergenic
989617567 5:43352250-43352272 GGGGTGGGGTGGGGTGGGGGTGG + Intergenic
989619335 5:43368998-43369020 GAGGTGGGGTGGGGGGCAGGGGG + Intergenic
990210519 5:53478816-53478838 CGGGAGGGGAGGGGCTCGGGCGG - Intergenic
990302677 5:54464315-54464337 CGGGGGGTCAGGGGTGGAGGTGG - Intergenic
990879099 5:60520259-60520281 GGGGTGGGTTGGGGTACAGGAGG - Intronic
991446274 5:66703141-66703163 CATGTGGGGAGGGGAGTAGGGGG + Intronic
991634374 5:68689656-68689678 TGAGAGGGGAGGGGTGCAGAGGG + Intergenic
992110785 5:73491065-73491087 AGGGTGGGGAGTGGTGGAGAAGG + Intergenic
992124367 5:73626027-73626049 CGGGCCGGGAGGTGGGCAGGCGG + Intergenic
992204260 5:74414855-74414877 GGGGTGGCGGGGGGTGCTGGTGG - Intergenic
992312069 5:75511321-75511343 CCGGTGTGGGGGGGAGCAGGAGG + Exonic
992530103 5:77645238-77645260 CGGGCGGGGAGGGGCGCGGGCGG - Intergenic
992564635 5:77985489-77985511 CGGGTGGTGGTGGGGGCAGGAGG + Intergenic
992762459 5:79962651-79962673 CGGGTAGGGGCCGGTGCAGGAGG - Intergenic
992853841 5:80839877-80839899 GGGCTGGGGAGGGTAGCAGGGGG - Intronic
992939916 5:81751426-81751448 CGCGGGGGGAGGGGTGGCGGCGG - Intronic
993049778 5:82912888-82912910 CGGGTGGAGAGTGGAGGAGGAGG + Intergenic
993684663 5:90923775-90923797 GTGGTGGGGTGGGGGGCAGGGGG - Intronic
993905718 5:93621250-93621272 CGGCTGAGGCGGGGCGCAGGCGG - Intronic
994085134 5:95750295-95750317 CCTGTGGGGAGGGGTGCAACTGG - Intronic
994457191 5:100025698-100025720 GGGGTGGGGGGGGGGGCGGGGGG + Intergenic
994457195 5:100025705-100025727 GGGGGGGGGCGGGGGGCAGGGGG + Intergenic
994865376 5:105262108-105262130 TGGTTGGGGAGGGGTGGATGTGG + Intergenic
995064412 5:107843864-107843886 AGTGTGGGGAGGGGGGCACGTGG + Intergenic
995190503 5:109314689-109314711 CGGGGGGTGGGCGGTGCAGGGGG + Intergenic
995538881 5:113165043-113165065 CAGATGGGGTGGGGTGCAGGAGG - Intronic
996443028 5:123512674-123512696 CGGGTGGGGTGGGGTGCGGCGGG + Intronic
996609176 5:125359146-125359168 GTGGTGGGGAGGGGGGAAGGGGG - Intergenic
996631114 5:125633660-125633682 GGGGAGGGGAGGGGAGGAGGGGG + Intergenic
996651336 5:125880489-125880511 CAGATGGGGAGGGTTGCAAGGGG - Intergenic
997297462 5:132777056-132777078 CGGGAGGCGCGGGGCGCAGGAGG - Intronic
997298652 5:132786001-132786023 CTGCTGGGGTGGGGAGCAGGGGG + Intronic
997479981 5:134177449-134177471 GGGGTGGGGTGGGGTGGGGGTGG + Intronic
997627272 5:135339573-135339595 CGGCTGGGGAGGAGTAGAGGTGG + Intronic
998034020 5:138898150-138898172 GGGGTGGGGGGGGGTGGGGGAGG - Intronic
998132877 5:139660032-139660054 CGGGTGGGCAGGCAGGCAGGAGG + Intronic
998139779 5:139693269-139693291 GGTGTGGGCAGGGGTGCAGGGGG + Intergenic
998173083 5:139883684-139883706 AGGATGGGTAGGTGTGCAGGTGG + Intronic
998401138 5:141849718-141849740 GGGGTGGGGAGGGGCGGAGGAGG + Intergenic
998401338 5:141850522-141850544 GGGGTGGGGGGGGGTGGGGGTGG + Intergenic
998819684 5:146047451-146047473 GGGGTGGGGAGAGGGACAGGAGG + Intronic
999143367 5:149377301-149377323 GGGGTGGGAAGGTGTCCAGGAGG - Intronic
999171249 5:149597094-149597116 CTGGTGGGATGGGGTGTAGGGGG + Intronic
999278584 5:150349374-150349396 CGGGTGGCGAGGGATGGTGGTGG - Intergenic
999394805 5:151220774-151220796 GGGGTGGGGACTGGTGCAGGAGG - Intronic
999768593 5:154757786-154757808 CAGGGGGGAAGGGGAGCAGGGGG - Intronic
999768601 5:154757802-154757824 CAGGGGGGAAGGGGAGCAGGGGG - Intronic
999768609 5:154757818-154757840 CAGGGGGGAAGGGGAGCAGGGGG - Intronic
999768617 5:154757834-154757856 CAGGGGGGAAGGGGAGCAGGGGG - Intronic
1000185308 5:158852032-158852054 AGGGTGGGGAGGGGAGGAGAGGG + Intronic
1000304513 5:159983322-159983344 CGGGTGGGGATGGGGGATGGTGG - Intergenic
1000330407 5:160200849-160200871 TGGGTGGGGAGAGGGGAAGGTGG + Intronic
1001648849 5:173301315-173301337 CGGGAGGGGAGGGGAGGAGAGGG - Intergenic
1001731619 5:173964524-173964546 GGGGTGGGGTGGGGTGAGGGTGG + Intergenic
1001731627 5:173964540-173964562 AGGGTGGGGTGGGGTGAGGGTGG + Intergenic
1001731651 5:173964589-173964611 GGGGTGGGGTGGGGTGAGGGTGG + Intergenic
1001731664 5:173964616-173964638 AGGGTGGGGTGGGGTGAGGGTGG + Intergenic
1001734712 5:173988941-173988963 CGCGTGGGGATGGGGGGAGGGGG - Intronic
1001863813 5:175085110-175085132 GGGGCGGGAGGGGGTGCAGGGGG + Intergenic
1001927938 5:175652665-175652687 GGGGTGGAGAGGGATCCAGGAGG - Intergenic
1001944899 5:175770764-175770786 CGGGTGGAGAGGAGTGGATGAGG - Intergenic
1002182920 5:177440854-177440876 CTGGTGGGGTGGGCTCCAGGAGG + Intronic
1002196285 5:177503458-177503480 CAGTGGGGGCGGGGTGCAGGTGG - Intronic
1002277586 5:178113816-178113838 GGGGTGGGGAGGGGTGGGGCGGG + Intronic
1002441184 5:179265319-179265341 CGGGAGGGGAGAGGTGGCGGGGG + Intronic
1002551319 5:179994975-179994997 CTGGTGGGGAGAGGTGAAGCTGG + Intronic
1002580875 5:180208947-180208969 GGGCTGGGGAGGGCTGCCGGCGG - Intronic
1002696976 5:181098316-181098338 CGGGTGGGGAGGGGTGGGGCGGG + Intergenic
1002697048 5:181098471-181098493 GGGGTGAGGAGGGGTGCGGAGGG + Intergenic
1002697574 5:181100918-181100940 GGGGTGGGGAGGGGTGGGGAGGG - Intergenic
1002697594 5:181100953-181100975 GGGGTGGGGAGGGGTGGGGAGGG - Intergenic
1002697632 5:181101023-181101045 GGGGTGGGGAGGGGTGGCGAGGG - Intergenic
1002926633 6:1609210-1609232 CGGCTGGGGAGGGGTCATGGAGG + Intergenic
1003190538 6:3870751-3870773 GGGGTGGGGAGCGGCACAGGAGG - Intergenic
1003289523 6:4767600-4767622 GGGGAGGGGAGGGGAGCAGAGGG + Intronic
1003291266 6:4780390-4780412 CGGGGGGGGGGGGGCGTAGGCGG - Intronic
1003552347 6:7109516-7109538 CGGGCGGGGCGGGGAGCTGGGGG + Intronic
1003637333 6:7844715-7844737 CGGGAGGAGAGGGGGCCAGGAGG + Intronic
1003773640 6:9335742-9335764 AGGGTAGGGAGGGAAGCAGGAGG - Intergenic
1003872201 6:10412411-10412433 CGGGTGGGGAGAGGGGAGGGAGG + Intronic
1004135883 6:12966085-12966107 CGAGGAGGAAGGGGTGCAGGAGG + Intronic
1004217565 6:13716810-13716832 CGGGTGGGCAGGGGCTCAGCAGG + Intergenic
1004510051 6:16277887-16277909 TGGGGAGGGAGGGGAGCAGGTGG + Intronic
1004562234 6:16761517-16761539 AGGGAGGGGAGGGGAGCGGGAGG - Intergenic
1004643993 6:17542095-17542117 GGGGCTGGGAGGGGTGCAGGGGG - Intronic
1004924009 6:20402121-20402143 CGGGCGGGGAGGAGAGAAGGAGG + Intronic
1005577810 6:27206187-27206209 GGGGTGGGGATGGGGGCGGGGGG - Intergenic
1005882007 6:30069242-30069264 AGGCTGGGGAGGGGTGGTGGGGG - Exonic
1006108030 6:31728408-31728430 AGGGAGGGAGGGGGTGCAGGTGG - Intronic
1006196237 6:32244233-32244255 CTGGTGGGGAGTGGAGGAGGTGG - Intergenic
1006285046 6:33086265-33086287 CTTGTGGGGTGGGTTGCAGGAGG + Intronic
1006295065 6:33166654-33166676 GGGGTGGAGAGGGGTGGAGTTGG - Intronic
1006334013 6:33411108-33411130 GGCGTGGGGGGGCGTGCAGGCGG - Exonic
1006342345 6:33453471-33453493 TGGGTGGGGAGGGAAGCAGAGGG - Exonic
1006498249 6:34439836-34439858 GGGGGGGGGGGGGGTGCAGGCGG - Intergenic
1006679685 6:35788042-35788064 TGGGTAGGGAGGAGAGCAGGTGG - Exonic
1006794032 6:36721067-36721089 GGGATGGTGAGGGCTGCAGGTGG + Intronic
1006799565 6:36751288-36751310 CGGGTGGGGTGGGATGAAGATGG - Intronic
1006931642 6:37692419-37692441 AAAGTGGGGAGGGGGGCAGGGGG + Intronic
1006981822 6:38153663-38153685 CAGGTGGGGAAGGGTGGGGGTGG + Exonic
1007378166 6:41470418-41470440 CGGGTGGGGCGGGGCGCTCGGGG - Intergenic
1007389939 6:41545375-41545397 GGGGTGGGGAGAAGTGAAGGAGG - Intergenic
1007393140 6:41561996-41562018 AGGATGGGGAAGGGTGCTGGCGG - Intronic
1007474396 6:42109108-42109130 CAGCAGGGGAGGGGTGCAGCAGG + Intronic
1007553278 6:42746287-42746309 TGGGTGGGGTGGGAGGCAGGCGG + Intergenic
1007695928 6:43734303-43734325 GGGGTGGGGAGAGGAGGAGGGGG - Intergenic
1007702598 6:43773463-43773485 CGGGTGGGGAGGGTTAGAGGAGG + Intronic
1007722166 6:43891521-43891543 GGGGTGGGGGGGGCGGCAGGAGG + Intergenic
1009016954 6:57916327-57916349 TGGGTGGGGTGGGGGGCAGGGGG + Intergenic
1009859590 6:69309955-69309977 AGGGTGGGGAAGGGTGGAGAAGG - Intronic
1010402662 6:75464797-75464819 GGGGTGGGGAAGGCTACAGGAGG - Intronic
1010779498 6:79929160-79929182 AGGTTGGGGAGGGGGGCGGGTGG + Intronic
1011743788 6:90389313-90389335 AGGGTGGGGAGGGGTGCCCAAGG - Intergenic
1012169885 6:96003407-96003429 CAGCTGTGGTGGGGTGCAGGTGG - Intergenic
1012398947 6:98828827-98828849 TGGGCGGGGAGGGGAGCAGGTGG - Intergenic
1012691274 6:102314560-102314582 TGGGTGGGGAGGGTGGAAGGAGG + Intergenic
1013341662 6:109221490-109221512 GGGGTGGGGAGGGGTGGGGAGGG - Intergenic
1013413789 6:109906162-109906184 AAGGTGGGGATGTGTGCAGGGGG + Intergenic
1013514922 6:110876010-110876032 CGGGGCGGGAGAGGTGCGGGTGG + Intronic
1013555193 6:111249768-111249790 CTGGTGGGCAGGTGTGCAGATGG + Intergenic
1013734059 6:113205356-113205378 TGTGTGGTGAAGGGTGCAGGGGG + Intergenic
1015181521 6:130366278-130366300 CGGGTGGCAAGGGGTGCAAGCGG - Intronic
1015220645 6:130801512-130801534 CGGCGGGGGAGGGGTGCGGCAGG + Intergenic
1015749686 6:136548089-136548111 GGGGTGGGGGGGGGTGGTGGTGG - Intronic
1015840654 6:137473418-137473440 AGGGAGGGGAGGGGCGGAGGTGG + Intergenic
1015945155 6:138492211-138492233 CATGTGGGGATGGGAGCAGGAGG + Intronic
1016510984 6:144842802-144842824 GGGGTGGGGAGGTGGGGAGGTGG - Intronic
1016839198 6:148508805-148508827 CGAGTGGGGAGGGGGGTGGGAGG + Intronic
1016923619 6:149318321-149318343 CGGGTGGGGGAGGGCGCAAGGGG + Intronic
1016940737 6:149481195-149481217 TGCGTGGGGAGGGATGGAGGTGG - Intronic
1017041230 6:150310099-150310121 TGGGTGGGGGCGGGTGGAGGTGG - Intergenic
1017406747 6:154127604-154127626 GGGGTGGGGAGGGTTGTAGCCGG - Intronic
1018027244 6:159816137-159816159 GGGGTGGGGAGGGGTGTGGCGGG - Intronic
1018027254 6:159816157-159816179 GGGGAGGGGAGGGGTGTGGGGGG - Intronic
1018070714 6:160161939-160161961 CTGCTGGGAAGAGGTGCAGGTGG - Intergenic
1018735064 6:166681680-166681702 CGGGGGGGGGGGCGGGCAGGGGG - Intronic
1018812603 6:167308550-167308572 CAGGTGGGGTGGGGTGCAGGAGG + Intronic
1018879346 6:167861089-167861111 GGGGAGAGGAGGGGTGCAGAGGG - Intronic
1019160223 6:170064409-170064431 CGGATGGGAGGGGATGCAGGAGG + Intergenic
1019188547 6:170236133-170236155 CTGTGGGGGAGTGGTGCAGGGGG - Intergenic
1019341363 7:510486-510508 CGGGTGGGGAGGGGAGGGGAGGG + Intronic
1019341399 7:510584-510606 CGGGTGGGGAGGGGAGGGGAGGG + Intronic
1019344514 7:522746-522768 CGGGTGCGGGGAGGTGCTGGTGG + Intergenic
1019375818 7:691402-691424 CTGGTCAGGAGGGGTGCAGGAGG + Intronic
1019431477 7:1001682-1001704 CGGGTGGGGAGTCCTGCGGGTGG + Intronic
1019431549 7:1001916-1001938 CGGGTGGGGAGTCCTGCGGGTGG + Intronic
1019535332 7:1526303-1526325 GGGGAGGGGAGGGGAGGAGGAGG + Intergenic
1019541028 7:1551056-1551078 GAGGTGGGGGTGGGTGCAGGAGG + Intronic
1019572780 7:1720722-1720744 CGGGGGGTGGGGGGTGCTGGGGG - Intronic
1019669637 7:2270575-2270597 GCGGTGGGCAGGGGTGCAGTGGG - Intronic
1019764979 7:2843705-2843727 GGGGGGGAGTGGGGTGCAGGCGG + Intronic
1019797301 7:3060339-3060361 GGGGTAGGGAGGGGTGACGGAGG - Intergenic
1019940071 7:4282742-4282764 AGGGTGGTGTGGGGGGCAGGTGG + Intergenic
1020055698 7:5116536-5116558 AGGGCCGGGAGGTGTGCAGGGGG + Intergenic
1020083014 7:5296591-5296613 GGGGTGGGGTGGGATGCAGCTGG + Intronic
1020979980 7:15054780-15054802 CGGGTGGGGTGGGGGGGTGGCGG - Intergenic
1021634948 7:22682805-22682827 GGGGTGGGGGTGGGTGCAAGGGG + Intergenic
1022034342 7:26519390-26519412 GGGGAGGGCCGGGGTGCAGGTGG + Intergenic
1022094219 7:27129136-27129158 CAGATGGGGAGGGGTGGATGAGG + Exonic
1022410698 7:30136305-30136327 CGGGGTGGGAGGGGTGGAGTAGG + Intronic
1022497624 7:30862987-30863009 AGGCTGGGGAGGGGGGCAGCAGG - Intronic
1023292283 7:38680798-38680820 AGGGTATGGAGGGTTGCAGGAGG - Intergenic
1023579450 7:41665728-41665750 GGGGTGGGGGGGGGGGAAGGGGG + Intergenic
1023836764 7:44073175-44073197 TTGGCGGGGAGGGGTGAAGGTGG + Exonic
1023867942 7:44247615-44247637 CGGCTGGGGGTGGGGGCAGGGGG + Intronic
1023939774 7:44761981-44762003 GGGGTGGGGCGGGGTGTGGGCGG + Intronic
1023990933 7:45127850-45127872 GGTGTGGGGTGGGGGGCAGGGGG - Intergenic
1024565219 7:50674947-50674969 GGGGTGGGGAGGAGAGAAGGGGG - Intronic
1025762263 7:64405629-64405651 CGAGTGGGGAGGGGGCGAGGGGG - Intergenic
1025814052 7:64893659-64893681 GGGGTGGGGAGGGGGACGGGAGG - Intronic
1026010096 7:66629364-66629386 TGGGTGGGTAGGGGTGCAGGTGG - Intronic
1026517289 7:71084091-71084113 AGGGAGGGGAGGGGAGGAGGAGG - Intergenic
1026566929 7:71496777-71496799 GGGGTGGGGTGGGGAGCGGGGGG + Intronic
1026672613 7:72403172-72403194 GGGGTGGCGCGGGGTCCAGGAGG - Intronic
1026826057 7:73582274-73582296 GGGGTAGGGAGGGGTGCGAGGGG + Intergenic
1026830564 7:73607543-73607565 TGGGTGGGCAGGTGGGCAGGTGG + Intronic
1026830567 7:73607551-73607573 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1026834288 7:73627755-73627777 CGGGTGGGGTGCTGTGGAGGAGG + Intergenic
1026894135 7:74000289-74000311 CGGGTGGGGGGGGGCGGGGGCGG + Intergenic
1026979686 7:74519103-74519125 AGGAAGGGGAGGGGTGCAGCAGG + Intronic
1027479238 7:78673695-78673717 GCGGCGGGGAGGGGGGCAGGCGG + Intronic
1028405429 7:90468954-90468976 TGGTTGGGGAGGGGTAGAGGTGG - Intronic
1028567367 7:92246933-92246955 TGGGTGGGGATAGGTGCAGATGG + Intronic
1029117658 7:98245471-98245493 TTGGAGGGGCGGGGTGCAGGGGG + Intronic
1029150137 7:98474387-98474409 GGGGTGGGGTGGGGTGGGGGGGG + Intergenic
1029160693 7:98549404-98549426 GGGGTGGGGAGGGGGGCTGCAGG - Intergenic
1029169198 7:98618572-98618594 CGGAGGGGGAGGGGGGGAGGGGG - Intronic
1029199169 7:98827238-98827260 GGGGTGGGGAGTGGGGGAGGGGG - Intergenic
1030733913 7:113021462-113021484 AGGGTTGGGTGGGGGGCAGGTGG - Intergenic
1031101580 7:117486870-117486892 TGGGTGGGGTGGGGGGGAGGGGG + Intronic
1031895849 7:127347385-127347407 GGGGTGGGGAGGTGGGCGGGGGG + Intronic
1031976329 7:128095873-128095895 CGGCTATGGAGGGGTGCATGAGG - Intergenic
1032095240 7:128935009-128935031 TGGCTGGGGTGGGGAGCAGGGGG - Intergenic
1032263023 7:130351676-130351698 ATGATGGGGAGGGGTCCAGGAGG + Intronic
1032387499 7:131534540-131534562 AGGGTGGGGTGGGGGTCAGGAGG + Intronic
1032390037 7:131549896-131549918 GGGGTGGGGATGGTTGGAGGTGG + Intronic
1032435325 7:131896094-131896116 CAGCTGCGTAGGGGTGCAGGTGG + Intergenic
1032477514 7:132222463-132222485 GGTGGGGGGAGGGGGGCAGGAGG - Intronic
1032548015 7:132759583-132759605 TGAGTGGGGAGGGGAGCAAGCGG + Intergenic
1033037961 7:137892729-137892751 GGGGTGGGAAGGGATTCAGGGGG - Intronic
1033267304 7:139897333-139897355 GGGGTGGGGAGGGGGACCGGGGG + Intronic
1033267948 7:139902257-139902279 GGGGTGGTGATGGGTGCATGTGG - Intronic
1033288493 7:140062215-140062237 GGGGTGGGGAGGGAGGGAGGCGG - Intronic
1033360894 7:140638503-140638525 TGGGTGGGGAGGCCTGGAGGAGG - Intronic
1033570950 7:142627548-142627570 GGGGTGGGGCGGGGGGGAGGGGG + Intergenic
1033653929 7:143361363-143361385 CGGGGGGAGAGGGGAGCGGGAGG + Intronic
1033899438 7:146116864-146116886 CGGGAGGCGAAGGATGCAGGCGG + Exonic
1033969832 7:147025436-147025458 GGGGAGGGGAGGGGAGGAGGGGG + Intronic
1034129011 7:148698852-148698874 CGGGCGGGCAGGGGAGGAGGAGG + Intronic
1034272708 7:149811167-149811189 GGGGGAGGGAGGGGCGCAGGAGG - Intergenic
1034560747 7:151877798-151877820 GGGGTGGGGTGGGGTGAGGGTGG - Intergenic
1035022886 7:155809416-155809438 GGGCAGGGGCGGGGTGCAGGAGG - Intronic
1035047851 7:155980974-155980996 AGAGTGGGGAGGGCTGCAGCGGG + Intergenic
1035210754 7:157326344-157326366 CGCGTGGGGTGGGGTGCGGTTGG + Intergenic
1035222258 7:157413002-157413024 CGGGGAGCGCGGGGTGCAGGGGG + Intronic
1035251392 7:157599849-157599871 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251397 7:157599865-157599887 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251402 7:157599881-157599903 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251412 7:157599911-157599933 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251417 7:157599927-157599949 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251430 7:157599975-157599997 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251435 7:157599991-157600013 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251440 7:157600007-157600029 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251445 7:157600023-157600045 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251450 7:157600039-157600061 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251468 7:157600101-157600123 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251473 7:157600117-157600139 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251486 7:157600165-157600187 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251491 7:157600181-157600203 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251496 7:157600197-157600219 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251501 7:157600213-157600235 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035270185 7:157715198-157715220 CAGGTGGGGAGGGCTGGAGGCGG + Intronic
1035305447 7:157928711-157928733 GGGGTGGGGAGGGGGGCAGAGGG + Intronic
1035616927 8:1009004-1009026 TGGGTGGGAAGGGGTACTGGAGG - Intergenic
1035724053 8:1813782-1813804 AGGTTGGGGAGTGGGGCAGGGGG - Intergenic
1035724063 8:1813802-1813824 GGGTCGGGGAGGGGGGCAGGAGG - Intergenic
1036048915 8:5174181-5174203 CCAGTGGGGAGGGGAGCAAGGGG - Intergenic
1036263323 8:7257063-7257085 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036264626 8:7264685-7264707 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036265925 8:7272307-7272329 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036267227 8:7279929-7279951 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036268530 8:7287551-7287573 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036269834 8:7295173-7295195 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036295194 8:7529187-7529209 GGGGAGGGGAGGAGTGGAGGAGG - Intergenic
1036298059 8:7551881-7551903 GGGGTGGGGACGGGGGGAGGCGG - Intergenic
1036300669 8:7567179-7567201 GGGGTGGGGACGGGGGGAGGCGG - Intergenic
1036315367 8:7715602-7715624 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036316671 8:7723250-7723272 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036317978 8:7730898-7730920 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036319285 8:7738546-7738568 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036320594 8:7746193-7746215 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036321904 8:7753841-7753863 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036323213 8:7761489-7761511 GGGGTGGGGACGGGGGGAGGGGG + Intergenic
1036324512 8:7769136-7769158 GGGGTGGGGACGGGGGGAGGCGG + Intergenic
1036327376 8:7791831-7791853 GGGGAGGGGAGGAGTGGAGGAGG + Intergenic
1036351522 8:8015171-8015193 GGGGTGGGGACGGGGGGAGGTGG - Intergenic
1036354119 8:8030465-8030487 GGGGTGGGGACGGGGGGAGGGGG - Intergenic
1036604709 8:10294859-10294881 CGGCTTGGGAGGGGTGGGGGCGG + Intronic
1037004361 8:13759325-13759347 GGGGTGGGGAGGGGTGGGGAGGG - Intergenic
1037004367 8:13759335-13759357 GGGGTGGGGAGGGGTGGGGAGGG - Intergenic
1037582422 8:20253468-20253490 CTGGAGGGGCGGGGTGCAGCTGG + Exonic
1037752944 8:21694428-21694450 AGAGTGGGGATGGGTGCAGAAGG - Intronic
1037769246 8:21789296-21789318 AGGGTGGGGAGAGCTGCGGGGGG - Intronic
1037801788 8:22040023-22040045 CTGGGGGGGTGGGGTTCAGGAGG - Intergenic
1037879410 8:22565717-22565739 CGGGAGGGGAGGAGAGCGGGCGG - Intronic
1037886590 8:22599221-22599243 AGGGTGGGGAGGGGAGAGGGAGG - Intronic
1037977306 8:23222879-23222901 GGGGTGGGGAGGATGGCAGGAGG - Intronic
1037996051 8:23353002-23353024 GGGGTGGGGAGGGGTGGAGTGGG + Intronic
1038411317 8:27361830-27361852 TGGGTGTGGAGCGGAGCAGGGGG - Intronic
1038492805 8:27982379-27982401 GGGGTGGGGTGGGGGGCGGGAGG + Intronic
1038701784 8:29855768-29855790 AGGGTGGGGAGGGCTGGAGCTGG - Intergenic
1038737308 8:30182799-30182821 CAGGGCGGCAGGGGTGCAGGTGG - Intronic
1038807985 8:30812465-30812487 CGGGTGGGGAGGGGGGAGGGCGG - Exonic
1038971940 8:32646535-32646557 GGGGTGGGGGGTGGTGTAGGTGG - Intronic
1039052206 8:33505259-33505281 AGGGTGGGGAGGGGGAAAGGAGG + Intronic
1039165897 8:34679743-34679765 TGTGTGGGGAGGTGTGTAGGAGG - Intergenic
1039441995 8:37601564-37601586 TGGGTGGGGAGGGCTGAAGATGG - Intergenic
1039454614 8:37698449-37698471 CGGGCGGGGGGAGGTGCAGATGG - Exonic
1039781711 8:40792696-40792718 GGGGAGGGGAGGGGAGGAGGTGG + Intronic
1039897253 8:41725219-41725241 GGGGAGGGGCGGGGTGCAGGAGG + Intronic
1040006838 8:42628148-42628170 CAGGTTGGGAATGGTGCAGGGGG - Intergenic
1041029739 8:53724588-53724610 GGGGTGGGGCGGGGAGGAGGGGG - Intronic
1041031449 8:53739922-53739944 TGGGTGAGGAGCGGTGGAGGAGG - Intronic
1041633559 8:60116587-60116609 GGGGTGGGGTGGGGTGGTGGAGG - Intergenic
1042040348 8:64582130-64582152 GGGGTGGGGAGGGAGGGAGGAGG + Exonic
1042317123 8:67436063-67436085 TGGTGGGGGTGGGGTGCAGGAGG - Intronic
1042564567 8:70099066-70099088 GGGGAGGGGAGGGGAGAAGGAGG + Intergenic
1042737397 8:72004667-72004689 TCGGTGGGGAGAGGTGCGGGGGG - Intronic
1043438202 8:80254434-80254456 GGGGTGGGGTGGGGTGGAGAAGG - Intergenic
1044242497 8:89902852-89902874 GGGGATGGGAGGGGAGCAGGCGG + Intronic
1044667076 8:94641775-94641797 CGGGTGGGGGGTGGGGCGGGGGG + Intronic
1044784943 8:95783686-95783708 GGGGTGTGGCGGGGGGCAGGAGG - Intergenic
1045431396 8:102118190-102118212 CTGGTGGGGAGGCATCCAGGTGG - Intronic
1046626487 8:116581988-116582010 TGGGTTAGGAGGAGTGCAGGAGG - Intergenic
1046873023 8:119224683-119224705 TGGGTGGGGAGAGGAGAAGGAGG - Intronic
1047425205 8:124739084-124739106 CAGGGGGGCAGGGGGGCAGGGGG + Intergenic
1047932090 8:129738651-129738673 CTCGTGGGGTGGGGAGCAGGGGG + Intergenic
1048214300 8:132481013-132481035 CGGGCGGGGAGGGGCGCGGGTGG - Intergenic
1048269811 8:133019543-133019565 TGGGTGGGGAGGGGTGGTGATGG + Intronic
1048345393 8:133571542-133571564 GGGGTGGGGAGGGGACTAGGAGG - Intronic
1048440746 8:134457546-134457568 AGGGTCGGGCGGGGGGCAGGCGG - Intergenic
1048484223 8:134832134-134832156 CGCGAGGGGCGGGGGGCAGGGGG + Intergenic
1048485542 8:134844255-134844277 CGTGTGTGGAGAAGTGCAGGAGG + Intergenic
1048888908 8:138931078-138931100 TGGGAGGGGCGGGGAGCAGGTGG - Intergenic
1049108765 8:140629860-140629882 GGGGAGGGGAGGGGAGCAGGGGG + Intronic
1049196815 8:141320376-141320398 AGGGTGGGGACGGGTGCGGAAGG + Intergenic
1049256014 8:141614349-141614371 TGGGGGTGGAGGGGAGCAGGAGG - Intergenic
1049261029 8:141639316-141639338 GGGGTTTGGAGGGGTGCAGGGGG + Intergenic
1049333060 8:142065352-142065374 GGGGTGGGCATGGGTTCAGGGGG - Intergenic
1049375742 8:142288210-142288232 CGGCTGGGGCGGGGTGGAAGAGG + Intronic
1049383858 8:142331157-142331179 CAGCTGGGGAGGGGTTCTGGCGG - Intronic
1049396333 8:142402923-142402945 CCGGTGGGGAGGGGAGGGGGCGG - Intronic
1049416401 8:142497490-142497512 GGCTGGGGGAGGGGTGCAGGGGG + Intronic
1049456826 8:142696511-142696533 CGGGAGGTAAGGGTTGCAGGTGG - Intergenic
1049501906 8:142971537-142971559 TGGGTGGTGAGGGGTGAAGTGGG - Intergenic
1049575045 8:143386040-143386062 GGAGTGGGGAGGGGTGGGGGCGG + Intergenic
1049575756 8:143388907-143388929 CGGGTGGGGAGGAGGGGAAGAGG + Intergenic
1049637866 8:143698894-143698916 CGTGTGGGGAGGGGAGGAGTGGG - Intronic
1049760841 8:144331422-144331444 GAGGTGGGGAGGAGTGTAGGGGG + Exonic
1049830769 8:144699624-144699646 AGGGCGGGGCGGGGTGCTGGTGG + Intergenic
1049831597 8:144704592-144704614 CTGGGGAGGAGGGGAGCAGGTGG + Intergenic
1049879443 8:145052247-145052269 CGGGCGGGGCGGGGAGCGGGCGG - Intergenic
1049879456 8:145052274-145052296 CGGGCGGGGCGGGGCGCGGGCGG - Intergenic
1049979641 9:892410-892432 AGGGTGGGCAGGTGTGCAGGTGG - Intronic
1049987218 9:962550-962572 GGGGTGGGGTGGGGTGGAGGTGG + Intronic
1050351072 9:4741454-4741476 CGCGTGGGGGTGGGTGCAGAGGG - Intronic
1050356984 9:4792861-4792883 CGGGCGGGGAGGCGGGGAGGTGG + Exonic
1050457073 9:5844704-5844726 GGGATGAGGAGGGGTGCAGGAGG - Intergenic
1051053372 9:12956028-12956050 CAGGTGGGGAGGGGTGAAACCGG - Intergenic
1051146204 9:14030204-14030226 CGGGGGGGGGGGGGTGGCGGCGG + Intergenic
1051557852 9:18404897-18404919 AAGCTGGGGAGGGGTGCATGTGG - Intergenic
1051642746 9:19238587-19238609 GGGGAGGGGAGGGGAGGAGGGGG - Intronic
1051773446 9:20606320-20606342 AGGTGGGGGAGGGGTGAAGGCGG + Intronic
1051863559 9:21653004-21653026 TTGGTGGGGATGGGTGGAGGTGG + Intergenic
1052359766 9:27541260-27541282 AGGGTGGAGAGGTGTGCTGGGGG + Intergenic
1052747625 9:32455911-32455933 CTGGTGAGCAGTGGTGCAGGCGG - Exonic
1053167204 9:35853261-35853283 AGGGTGGGGAGGGATGTGGGGGG + Intronic
1053233800 9:36434290-36434312 GGGGAGGGGAGAGGAGCAGGAGG + Intronic
1053358295 9:37465344-37465366 CGGGGTGGGAGGGGGGCGGGTGG - Exonic
1054143703 9:61547883-61547905 CAGGAGGAGAGGTGTGCAGGGGG + Intergenic
1054463480 9:65479218-65479240 CAGGAGGAGAGGTGTGCAGGGGG + Intergenic
1055014825 9:71604963-71604985 TGGGTATGGAGGGGTGGAGGTGG - Intergenic
1055440571 9:76332325-76332347 AGGGAGGAGAGGGCTGCAGGAGG - Intronic
1055497369 9:76868833-76868855 GGGGTGGGGGGGGGGGCGGGGGG + Intronic
1056056288 9:82827112-82827134 AGTGTGGGGTGGGGTGGAGGGGG + Intergenic
1056138207 9:83649429-83649451 GGGGTGGGGTGGGGTGGGGGCGG - Intergenic
1056807597 9:89740974-89740996 GGGGTGGGGACGGGGGCAGGGGG - Intergenic
1056983892 9:91343169-91343191 GGTGGGGGCAGGGGTGCAGGTGG + Intronic
1057211052 9:93201329-93201351 GGAGTGGGGATGGGTCCAGGTGG + Intronic
1057259663 9:93576663-93576685 CGGGGGCGGCGGGGCGCAGGCGG - Exonic
1057695804 9:97322254-97322276 GGGCTGGGGAGGAGGGCAGGGGG - Intronic
1057869565 9:98708164-98708186 TGTGTGGGGAGGGGTGGGGGTGG - Intronic
1058023711 9:100117596-100117618 CGGGGGGGGCGGGGGGCCGGAGG - Intronic
1058535047 9:105950227-105950249 CTGGTGGGGTAGGGTGCTGGGGG + Intergenic
1058579624 9:106440973-106440995 TAGGTGGGGAGGGTTGCAGTGGG - Intergenic
1058893956 9:109383925-109383947 TGGTGGAGGAGGGGTGCAGGAGG - Intronic
1059206938 9:112476254-112476276 CGGGGGGGGGGGGGGGCGGGGGG - Intronic
1059375675 9:113879159-113879181 GGGCTGGGGAGGGGTGGAGGGGG + Intronic
1059450879 9:114370853-114370875 TGGGTGGGGATGGGGGGAGGGGG - Intronic
1059455521 9:114398071-114398093 AGGGAGGGGAGGGGTCCCGGGGG - Intergenic
1059977814 9:119736766-119736788 CAGGAGGGGAGGGGGGCAGATGG + Intergenic
1060124028 9:121024286-121024308 GGGGAGGGGAGGGGAGCGGGAGG + Intronic
1060214208 9:121728660-121728682 AGGGTGGGGAGGCCTGCAGCTGG + Intronic
1060485764 9:124045403-124045425 GCGGAGGGGAGGGGCGCAGGGGG + Intergenic
1060539443 9:124419785-124419807 CGGGCGGGGATGGGGGCAGCCGG + Intergenic
1060550883 9:124484864-124484886 CCTTTGGGGAGGGGTGGAGGGGG + Intronic
1060752652 9:126183664-126183686 GGGGTGGGGTGGGGTGGATGGGG + Intergenic
1060821010 9:126661658-126661680 CAGGTGGGGAGGGGTGGGCGGGG - Intronic
1060821116 9:126662044-126662066 GCGTGGGGGAGGGGTGCAGGGGG - Intronic
1060831376 9:126719806-126719828 AGGGTGGGAGGAGGTGCAGGCGG - Intergenic
1060897202 9:127225410-127225432 CGGACGGGGAGGGGTGCGGCCGG + Intronic
1060941587 9:127545868-127545890 CAGGCGGGGTGGGGGGCAGGAGG - Intronic
1061085214 9:128394096-128394118 GGTGGGGGGAGGGGAGCAGGTGG + Intergenic
1061127165 9:128684314-128684336 TGGATGTGGAGGGGTGAAGGAGG - Intronic
1061139005 9:128753098-128753120 CAGGTGGGGAGGAGTAGAGGTGG - Intronic
1061196499 9:129109899-129109921 AGGGTGGGGAAGGGGGCTGGAGG + Intronic
1061196513 9:129109935-129109957 AGGGTGGGGAAGGGGGCTGGAGG + Intronic
1061218927 9:129237638-129237660 CAGGTGGGGGGTGGTGGAGGTGG + Intergenic
1061228163 9:129293224-129293246 CAGGTCGGGTGGGGGGCAGGGGG - Intergenic
1061254531 9:129446741-129446763 GGGGTGGCGGGGGGAGCAGGAGG - Intergenic
1061491148 9:130944892-130944914 CAGGTGGGGAGGGGAGAAGAGGG + Intergenic
1061520513 9:131114809-131114831 TGGGTGGGGAGGGAAGCAGTAGG - Intronic
1061817468 9:133205609-133205631 CGCGTGGGGACAGGTGCAGGGGG + Exonic
1061955056 9:133957000-133957022 TGGGTGGGGAGCTGGGCAGGTGG - Intronic
1062038465 9:134393148-134393170 TGGGCAGGGAGGGGTGCAGCCGG + Intronic
1062046180 9:134425549-134425571 GGGGTGGGGGGGGGTGAGGGGGG + Intronic
1062051225 9:134448045-134448067 GGGTGGGGGAGGGGAGCAGGAGG + Intergenic
1062194088 9:135263783-135263805 GGGGTGGGGTAGGGGGCAGGGGG - Intergenic
1062236932 9:135514837-135514859 GGGGAGGGCAGGTGTGCAGGTGG + Intergenic
1062242938 9:135549617-135549639 CGAGTGGGGACAGGTGCAGGGGG - Exonic
1062245345 9:135563211-135563233 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245366 9:135563283-135563305 CAGGTGGGTAGGTGGGCAGGTGG + Intronic
1062245375 9:135563331-135563353 CAGGTGGGCAGGTGAGCAGGTGG + Intronic
1062245423 9:135563507-135563529 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245426 9:135563515-135563537 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245429 9:135563523-135563545 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062284619 9:135767566-135767588 GGGCTGGGTTGGGGTGCAGGAGG - Intronic
1062321073 9:135990801-135990823 CGGGAGGGGAGGGGTTAAAGGGG - Intergenic
1062349313 9:136131342-136131364 GGGGGGGGGAGGGGAGCATGGGG + Intergenic
1062380732 9:136285428-136285450 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380735 9:136285436-136285458 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380738 9:136285444-136285466 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1062380741 9:136285452-136285474 CAGGTGGGCAGGCGGGCAGGTGG + Intronic
1062380747 9:136285468-136285490 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380750 9:136285476-136285498 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380753 9:136285484-136285506 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062383140 9:136297302-136297324 CGGGTGGTGTGAGCTGCAGGTGG + Intronic
1062390379 9:136331413-136331435 AGGCTGGGGAGGGGGCCAGGTGG + Intronic
1062406160 9:136397634-136397656 CACGTGGGGAGGGGAGCACGTGG + Intronic
1062406166 9:136397650-136397672 CACGTGGGGAGGGGAGCACGTGG + Intronic
1062406172 9:136397666-136397688 CACGTGGGGAGGGGAGCACGTGG + Intronic
1062473925 9:136718471-136718493 AGGGTGTGGAGAGGGGCAGGGGG - Intronic
1062534534 9:137015639-137015661 CGTGTGGGCAGGGGTGCGGGCGG - Intronic
1062578851 9:137221040-137221062 GGGGTGGGCCGGGGAGCAGGCGG + Exonic
1203470177 Un_GL000220v1:112669-112691 CGGAAGGGGAAGGGTGCCGGCGG + Intergenic
1203477998 Un_GL000220v1:156641-156663 CGGAAGGGGAAGGGTGCCGGCGG + Intergenic
1185771732 X:2770010-2770032 CGTGTGTGGAGGGGTGGGGGGGG + Intronic
1186422290 X:9435883-9435905 CGGGTGGGCAGAGGTGCCTGGGG - Intergenic
1186546883 X:10459171-10459193 CTGGTAGGGTGGGGTGGAGGGGG + Intronic
1186880576 X:13862058-13862080 TGCGTGGGTGGGGGTGCAGGGGG + Intronic
1187225409 X:17371606-17371628 TGGGTGGTGAGGAGTGGAGGAGG - Intergenic
1187951647 X:24476580-24476602 GGGGTGGGGAGGGGTTCTGTGGG - Intronic
1188242654 X:27809497-27809519 CGGGCGGGGGGGGGGGCGGGCGG - Intronic
1189129757 X:38485528-38485550 CGGGTGGGGAGGGTGGGAAGAGG + Intronic
1189231156 X:39453522-39453544 CGGGTGGGGGGGGTTGGAGGAGG - Intergenic
1190726358 X:53193109-53193131 GTGGTGGGGATGGGTGCAGGGGG + Exonic
1190790717 X:53697336-53697358 AGGGTAGGGAGGCCTGCAGGTGG + Intergenic
1192166566 X:68830553-68830575 CGGGTGGAGAGGGGCGGAGTGGG + Intronic
1192177908 X:68897427-68897449 CTGGTGGGGATGGGAGCAGCAGG - Intergenic
1192185507 X:68944268-68944290 TGTGTGGGGATGAGTGCAGGGGG + Intergenic
1192230939 X:69264516-69264538 CAGGTGGGGAGGGGGGTGGGGGG + Intergenic
1192236204 X:69297717-69297739 AGGGTGGGCAGGGGAGCAGCTGG - Intergenic
1192371294 X:70515260-70515282 GGGGTGGGGGGGGGTGGAGGAGG - Intergenic
1193698779 X:84739673-84739695 GCTGTGGGGAGGGGGGCAGGAGG - Intergenic
1193807286 X:86010203-86010225 GGGGTGGGGGGGGCTGGAGGAGG + Intronic
1193969967 X:88039133-88039155 CGGGTCGGGCGGGGGGCGGGGGG - Intergenic
1194242571 X:91470086-91470108 TTGGTGGGGAGGTGGGCAGGTGG + Intergenic
1195419553 X:104658461-104658483 CTGGTGGGGTGGGAGGCAGGGGG + Intronic
1195566684 X:106347151-106347173 CGGGGCGGGTGGGGGGCAGGGGG + Intergenic
1196745222 X:119065832-119065854 CGGGTGGGGAGAGATGCGGGAGG - Intergenic
1196871352 X:120116091-120116113 AGTGTGGGGTGGGGTGCAGGTGG + Intergenic
1196951611 X:120930977-120930999 CGGGTAGATAGGGGTTCAGGAGG - Intronic
1196952295 X:120935838-120935860 CGGGTAGATAGGGGTTCAGGAGG - Intronic
1196952980 X:120940699-120940721 CGGGTAGATAGGGGTTCAGGAGG - Intronic
1196953665 X:120945559-120945581 CGGGTAGATAGGGGTTCAGGAGG - Intronic
1196954350 X:120950420-120950442 CGGGTAGATAGGGGTTCAGGAGG - Intronic
1196955033 X:120955280-120955302 CGGGTAGATAGGGGTTCAGGAGG - Intronic
1196955721 X:120960163-120960185 CGGGTAGATAGGGGTTCAGGAGG - Intronic
1196956402 X:120965024-120965046 CGGGTAGATAGGGGTTCAGGAGG - Intronic
1196957084 X:120969884-120969906 CGGGTAGATAGGGGTTCAGGAGG - Intronic
1196957766 X:120974744-120974766 CGGGTAGATAGGGGTTCAGGAGG - Intronic
1196958448 X:120979604-120979626 CGGGTAGATAGGGGTTCAGGAGG - Intronic
1196959129 X:120984464-120984486 CGGGTAGATAGGGGTTCAGGAGG - Intronic
1197272634 X:124442227-124442249 AGGGTGTGGTGGGGTGGAGGTGG + Intronic
1197661029 X:129172653-129172675 GGGGTGGGGAGTGGTGCGAGGGG - Intergenic
1197738966 X:129874604-129874626 CGGGAGGGGAAGGTTGCAGAGGG + Intergenic
1197920247 X:131584569-131584591 GGGGTGGGGTGGGGGGGAGGGGG + Intergenic
1197939454 X:131774279-131774301 TTGGTGGGGGGGGGAGCAGGGGG + Intergenic
1198125747 X:133642024-133642046 AGGGTGGGTGGGGGTGCAGTGGG - Intronic
1198705996 X:139448432-139448454 CGGGCAGGGAGGGGTGCTGGTGG + Intergenic
1198897189 X:141468620-141468642 GGGGTGGGGAGCGGTGCTGGCGG - Intergenic
1199143167 X:144335054-144335076 GGAGGGGGGAGGGGTGGAGGGGG - Intergenic
1199478178 X:148269208-148269230 TGTGTGGGGAGGGGGGCATGTGG + Intergenic
1199695375 X:150340201-150340223 GGGGTGGGGAGAGGTGGAGAGGG - Intergenic
1199976442 X:152897594-152897616 GGGGCGGGGAGGGGGGCGGGGGG - Intergenic
1200008961 X:153107381-153107403 TGGGGGGGGGGAGGTGCAGGTGG - Intergenic
1200030639 X:153292541-153292563 TGGGGGGGGGGAGGTGCAGGTGG + Intergenic
1200061661 X:153486442-153486464 CGAGTTGGGAGGGGGCCAGGAGG + Intronic
1200119363 X:153783194-153783216 CAGGTGGGGAGCGGTGGGGGGGG - Intronic
1200136256 X:153876094-153876116 AAGGTGGGGAGGGGTGCGGATGG - Intronic
1200225262 X:154413430-154413452 GTGGTGGAGCGGGGTGCAGGGGG + Intronic
1200229452 X:154436877-154436899 CGGGTGGGGCGGGGCGCGCGCGG + Intergenic
1200256143 X:154584471-154584493 CGTGTGGGGTGGGTTGCGGGTGG - Intergenic
1200261626 X:154619932-154619954 CGTGTGGGGTGGGTTGCGGGTGG + Intergenic
1200267608 X:154654229-154654251 CGTGTGGGGTGGGTTGCGGGTGG + Intergenic
1200775597 Y:7167485-7167507 TGTGTGGCGAGGGGAGCAGGGGG + Intergenic
1201109733 Y:10790437-10790459 GGGGTGGAGTGGGGTGGAGGGGG - Intergenic
1201337047 Y:12892588-12892610 TGGGTGGAAAGGGGTGAAGGGGG + Intergenic
1201582120 Y:15520423-15520445 AGGGTGGGAAGGGGTGAAGGAGG - Intergenic