ID: 1168148331

View in Genome Browser
Species Human (GRCh38)
Location 19:54431539-54431561
Sequence GGCTGCCGCTTAGTGAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168148321_1168148331 7 Left 1168148321 19:54431509-54431531 CCGTCCTCCTGCCTCTCCCTCCC 0: 1
1: 46
2: 1770
3: 67322
4: 54661
Right 1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
1168148325_1168148331 -4 Left 1168148325 19:54431520-54431542 CCTCTCCCTCCCTCCTAGAGGCT 0: 1
1: 0
2: 1
3: 58
4: 506
Right 1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
1168148327_1168148331 -10 Left 1168148327 19:54431526-54431548 CCTCCCTCCTAGAGGCTGCCGCT 0: 1
1: 0
2: 0
3: 21
4: 212
Right 1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
1168148320_1168148331 14 Left 1168148320 19:54431502-54431524 CCTCTCTCCGTCCTCCTGCCTCT 0: 1
1: 1
2: 10
3: 160
4: 1768
Right 1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
1168148323_1168148331 0 Left 1168148323 19:54431516-54431538 CCTGCCTCTCCCTCCCTCCTAGA 0: 1
1: 0
2: 7
3: 108
4: 1367
Right 1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
1168148326_1168148331 -9 Left 1168148326 19:54431525-54431547 CCCTCCCTCCTAGAGGCTGCCGC 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
1168148322_1168148331 3 Left 1168148322 19:54431513-54431535 CCTCCTGCCTCTCCCTCCCTCCT 0: 1
1: 14
2: 96
3: 881
4: 6414
Right 1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
1168148319_1168148331 27 Left 1168148319 19:54431489-54431511 CCTTGTCTTCTCTCCTCTCTCCG 0: 1
1: 0
2: 10
3: 109
4: 1029
Right 1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168148331 Original CRISPR GGCTGCCGCTTAGTGAGTTC TGG Intronic
901059712 1:6466295-6466317 CGCTGCCGCCTAATGAGCTCAGG - Exonic
901929166 1:12585889-12585911 GGCTGCCTCTTAGTGAACTCGGG + Intronic
905630654 1:39516375-39516397 GGCTGACGCTGAGGGAGCTCTGG + Intronic
907415561 1:54311675-54311697 GGCTGCTGCTCAGTGTGGTCAGG - Intronic
909922733 1:81401722-81401744 AGATGCTGCTTAGTGACTTCAGG - Intronic
917494452 1:175527340-175527362 GGCTGCCACTGAGGGTGTTCTGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1065822784 10:29541391-29541413 GGATGCAGCTTGGTGAGTTTGGG - Intronic
1065965256 10:30765685-30765707 GGCTGCAGCTGAGTGCCTTCTGG - Intergenic
1069580985 10:69566750-69566772 GGATGCTACTTAGTGAGATCAGG + Intergenic
1075483894 10:122804871-122804893 TGCTGCCGCCTGCTGAGTTCCGG + Intergenic
1089293160 11:117450534-117450556 GCCAGCCGGTAAGTGAGTTCAGG - Exonic
1089347498 11:117799827-117799849 GGCTGACGCATAGTGAGCACAGG + Intronic
1089462353 11:118660623-118660645 GGATGCCGCTAAGCGAGTTGGGG + Exonic
1090901270 11:131033787-131033809 GCCTGGCACTTAGTGAGTGCTGG - Intergenic
1090993217 11:131839530-131839552 GGCTGCAGCTAAGTGAGTCAGGG + Intronic
1096489558 12:52006422-52006444 GGCTTCTGCGCAGTGAGTTCAGG + Intergenic
1096539095 12:52294085-52294107 TGCTGTCCCTTTGTGAGTTCAGG + Intronic
1098383850 12:69897954-69897976 AGCTGCAGCTGTGTGAGTTCAGG + Intronic
1101757859 12:107635417-107635439 GGCTGCTGCTTTGTGATTTAAGG + Intronic
1105422363 13:20264429-20264451 GGCTGGTGCTGAGTAAGTTCAGG + Intergenic
1111347782 13:86984137-86984159 GGCAGCCACTTACTGATTTCTGG - Intergenic
1125906606 15:43398601-43398623 GGCTGCCAGTTTGTGAGCTCTGG + Intronic
1126250985 15:46567351-46567373 GGCTGTCCCATATTGAGTTCAGG - Intergenic
1128979963 15:72179015-72179037 GGGTGAGGCTTAGTGAGTTGGGG + Intronic
1131683758 15:94750385-94750407 GGCTGCAGCTGAGTGAGGCCAGG + Intergenic
1132840487 16:1976376-1976398 GGCTGCCGCTCAGGGAGCTGGGG + Intronic
1132875104 16:2133677-2133699 GGCCGCCGCTGGGAGAGTTCTGG - Intronic
1134519883 16:14913713-14913735 GGCCGCCGCTGGGAGAGTTCTGG + Intronic
1134554048 16:15152524-15152546 GGCCGCCGCTGGGAGAGTTCTGG - Intergenic
1134707555 16:16312367-16312389 GGCCGCCGCTGGGAGAGTTCTGG + Intergenic
1134959988 16:18399758-18399780 GGCCGCCGCTGGGAGAGTTCTGG - Intergenic
1141432767 16:83979422-83979444 GGCTGCGGCTGAGAGAGTCCTGG + Intronic
1143651311 17:8265691-8265713 GGCTCCTGCTTTGTGAGTGCTGG + Intronic
1144206014 17:12980002-12980024 TGCTGCCGCTCACTGAGTTCAGG + Intronic
1146925386 17:36740872-36740894 GGCTCTGGCTTAGTGAGGTCTGG - Intergenic
1154029053 18:10734521-10734543 GGCTGCCCCTGACTGAGTTCAGG + Intronic
1157549732 18:48573191-48573213 GGCTGCCGTTTTGTGACTTTAGG - Intronic
1161602617 19:5193777-5193799 GGCTGCTGCTTCCTGATTTCTGG + Intronic
1163692255 19:18744238-18744260 GGCGGCCGCTTGGGGAGCTCAGG - Intronic
1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG + Intronic
931547713 2:63407900-63407922 GGCTGCCCCTTTGTGAGTACAGG - Intronic
936070314 2:109365388-109365410 GGCTGCTGCTTGGGGATTTCTGG + Intronic
940882739 2:158962714-158962736 GGCTGAGGCTCAGTGAGCTCCGG - Intergenic
948733798 2:239984958-239984980 GGCTTCCGTTTTGTGAGGTCTGG - Intronic
948978853 2:241482341-241482363 GGCTGCTGCTTAGCCAGTGCTGG + Intronic
1171403466 20:24893782-24893804 TGCTGCCGCTGGGAGAGTTCAGG - Intergenic
1174302105 20:49589871-49589893 GGCTGGAGCTGAGTGAGTTGGGG - Intergenic
1180731497 22:17985711-17985733 TGCTGCTGCACAGTGAGTTCAGG - Intronic
1183155176 22:36069413-36069435 GGGAGCCTCCTAGTGAGTTCTGG - Intergenic
952250490 3:31648543-31648565 GGCTGCCTGGTGGTGAGTTCAGG - Intergenic
957735545 3:84197320-84197342 GGCTCCTGATTGGTGAGTTCAGG - Intergenic
962904676 3:139790916-139790938 GGGAGCAGCTTAGTTAGTTCTGG + Intergenic
967104126 3:186241943-186241965 GGCTGGGACTTAGTGGGTTCCGG + Intronic
972564385 4:40257084-40257106 GGCTGGGGCTTTGTGTGTTCAGG + Intergenic
977426626 4:96874876-96874898 GGCTGCCCCTGGGTGAATTCAGG + Intergenic
997527248 5:134561248-134561270 GGCTGCCTTTTAGTAAATTCAGG - Intronic
998335082 5:141364558-141364580 AGCTGCCGCTTCGCGGGTTCAGG - Exonic
998374552 5:141682167-141682189 GGCGGCCGCGTAGTGAGGTGAGG - Exonic
1012715818 6:102667926-102667948 AGCTGCAGCTTAGAGAGTTGTGG - Intergenic
1015221640 6:130810841-130810863 GGCTGCCGCTTAGAGATTCATGG - Intergenic
1016207251 6:141484099-141484121 GACTTGCGGTTAGTGAGTTCTGG + Intergenic
1028288126 7:89029828-89029850 GGCTGCTGCTTAGGAATTTCAGG + Intronic
1028510591 7:91621070-91621092 GGCTGGCGCTTGGTGAGTGAAGG - Intergenic
1029689199 7:102169615-102169637 GGCAGCAGCTCAGTGAGTTTGGG + Intronic
1034986850 7:155521544-155521566 GGCTGCCGCCTGGCGATTTCAGG - Intronic
1037259440 8:16991304-16991326 GGCTGGAGCTTAGTGAGCTATGG - Intergenic
1037275706 8:17175956-17175978 GGCTGCAGCTTAGTGAGCAAAGG + Intronic
1039907454 8:41797501-41797523 GGCTTCCGCGAAGTGAGTACTGG - Intronic
1040639989 8:49321861-49321883 GGCTTCCACTTAGTCACTTCAGG - Intergenic
1046774127 8:118146003-118146025 GGCTGCCACATAGTGTGATCAGG + Intergenic
1050037386 9:1451479-1451501 GGCGGGCGCATAGTGAGGTCAGG - Intergenic
1058840070 9:108897854-108897876 GTGTGCCACTTAGTGAGTTTTGG - Intronic
1062041562 9:134406753-134406775 GGCTGCGGCTCAGGGAGGTCAGG - Intronic
1062316121 9:135967670-135967692 GGCTGCTGCTTGTTGAGTTTCGG - Intergenic
1062586889 9:137253537-137253559 GGCTGCCGCTGGGTCATTTCCGG + Intergenic
1187776629 X:22767048-22767070 GGCATTTGCTTAGTGAGTTCAGG + Intergenic
1199710206 X:150463677-150463699 GGCTGCTGCTCAGATAGTTCTGG + Intronic
1201549462 Y:15204635-15204657 CCCTTCCGCTTAGTGAGTTTGGG + Intergenic