ID: 1168150950

View in Genome Browser
Species Human (GRCh38)
Location 19:54448450-54448472
Sequence CTGGAAGGGCGCAGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168150950_1168150958 -9 Left 1168150950 19:54448450-54448472 CCCCCTCCCCTGCGCCCTTCCAG No data
Right 1168150958 19:54448464-54448486 CCCTTCCAGATTCATTTGCTAGG No data
1168150950_1168150962 8 Left 1168150950 19:54448450-54448472 CCCCCTCCCCTGCGCCCTTCCAG No data
Right 1168150962 19:54448481-54448503 GCTAGGGAAGCCCGCTCTTCCGG No data
1168150950_1168150964 12 Left 1168150950 19:54448450-54448472 CCCCCTCCCCTGCGCCCTTCCAG No data
Right 1168150964 19:54448485-54448507 GGGAAGCCCGCTCTTCCGGGTGG No data
1168150950_1168150960 -8 Left 1168150950 19:54448450-54448472 CCCCCTCCCCTGCGCCCTTCCAG No data
Right 1168150960 19:54448465-54448487 CCTTCCAGATTCATTTGCTAGGG No data
1168150950_1168150963 9 Left 1168150950 19:54448450-54448472 CCCCCTCCCCTGCGCCCTTCCAG No data
Right 1168150963 19:54448482-54448504 CTAGGGAAGCCCGCTCTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168150950 Original CRISPR CTGGAAGGGCGCAGGGGAGG GGG (reversed) Intergenic
No off target data available for this crispr