ID: 1168152379

View in Genome Browser
Species Human (GRCh38)
Location 19:54456027-54456049
Sequence CTGCCCCTCTAGGAGGGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 218}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168152379_1168152397 26 Left 1168152379 19:54456027-54456049 CCTTCACCCTCCTAGAGGGGCAG 0: 1
1: 1
2: 1
3: 22
4: 218
Right 1168152397 19:54456076-54456098 CCGTCCCAGCGAGGGACGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 75
1168152379_1168152391 -1 Left 1168152379 19:54456027-54456049 CCTTCACCCTCCTAGAGGGGCAG 0: 1
1: 1
2: 1
3: 22
4: 218
Right 1168152391 19:54456049-54456071 GGCTCGGCGACAAGGGGCGGGGG 0: 1
1: 1
2: 1
3: 8
4: 103
1168152379_1168152392 17 Left 1168152379 19:54456027-54456049 CCTTCACCCTCCTAGAGGGGCAG 0: 1
1: 1
2: 1
3: 22
4: 218
Right 1168152392 19:54456067-54456089 GGGGGTGCCCCGTCCCAGCGAGG 0: 1
1: 0
2: 0
3: 10
4: 129
1168152379_1168152388 -4 Left 1168152379 19:54456027-54456049 CCTTCACCCTCCTAGAGGGGCAG 0: 1
1: 1
2: 1
3: 22
4: 218
Right 1168152388 19:54456046-54456068 GCAGGCTCGGCGACAAGGGGCGG 0: 1
1: 0
2: 1
3: 12
4: 157
1168152379_1168152386 -8 Left 1168152379 19:54456027-54456049 CCTTCACCCTCCTAGAGGGGCAG 0: 1
1: 1
2: 1
3: 22
4: 218
Right 1168152386 19:54456042-54456064 AGGGGCAGGCTCGGCGACAAGGG 0: 1
1: 0
2: 0
3: 13
4: 89
1168152379_1168152387 -7 Left 1168152379 19:54456027-54456049 CCTTCACCCTCCTAGAGGGGCAG 0: 1
1: 1
2: 1
3: 22
4: 218
Right 1168152387 19:54456043-54456065 GGGGCAGGCTCGGCGACAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 95
1168152379_1168152398 27 Left 1168152379 19:54456027-54456049 CCTTCACCCTCCTAGAGGGGCAG 0: 1
1: 1
2: 1
3: 22
4: 218
Right 1168152398 19:54456077-54456099 CGTCCCAGCGAGGGACGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 116
1168152379_1168152399 28 Left 1168152379 19:54456027-54456049 CCTTCACCCTCCTAGAGGGGCAG 0: 1
1: 1
2: 1
3: 22
4: 218
Right 1168152399 19:54456078-54456100 GTCCCAGCGAGGGACGCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 79
1168152379_1168152390 -2 Left 1168152379 19:54456027-54456049 CCTTCACCCTCCTAGAGGGGCAG 0: 1
1: 1
2: 1
3: 22
4: 218
Right 1168152390 19:54456048-54456070 AGGCTCGGCGACAAGGGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1168152379_1168152393 18 Left 1168152379 19:54456027-54456049 CCTTCACCCTCCTAGAGGGGCAG 0: 1
1: 1
2: 1
3: 22
4: 218
Right 1168152393 19:54456068-54456090 GGGGTGCCCCGTCCCAGCGAGGG 0: 1
1: 0
2: 1
3: 9
4: 99
1168152379_1168152385 -9 Left 1168152379 19:54456027-54456049 CCTTCACCCTCCTAGAGGGGCAG 0: 1
1: 1
2: 1
3: 22
4: 218
Right 1168152385 19:54456041-54456063 GAGGGGCAGGCTCGGCGACAAGG 0: 1
1: 0
2: 2
3: 20
4: 176
1168152379_1168152389 -3 Left 1168152379 19:54456027-54456049 CCTTCACCCTCCTAGAGGGGCAG 0: 1
1: 1
2: 1
3: 22
4: 218
Right 1168152389 19:54456047-54456069 CAGGCTCGGCGACAAGGGGCGGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168152379 Original CRISPR CTGCCCCTCTAGGAGGGTGA AGG (reversed) Exonic
900406077 1:2493598-2493620 CTGGCTCCCTATGAGGGTGAAGG + Intronic
904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG + Intronic
904118451 1:28179212-28179234 CTGTCCCTCCTGGAGGGTGGTGG - Intronic
904383263 1:30125475-30125497 CTGCCCCTCTGCGGTGGTGATGG + Intergenic
904938805 1:34150661-34150683 CTGGCCCTTTGGGAGGCTGAAGG + Intronic
905503615 1:38459027-38459049 TTGCCCCTCTAGGAAAGTAAAGG - Intergenic
906145697 1:43558794-43558816 CTTTCCCTCCAGGAGGTTGAGGG + Intronic
906405567 1:45539334-45539356 CTCCCCCTCCAGGAAGGAGAAGG - Intergenic
909090109 1:71215107-71215129 CTGCCCTTTTAGGAGGGTGGAGG + Intergenic
909767300 1:79372209-79372231 CTGCCTCTCTAGTTGTGTGAAGG + Intergenic
910136026 1:83970989-83971011 CTGCTCTTCTGGGAGGGGGAAGG + Intronic
911092565 1:94029512-94029534 CTGCACCTGCAGGATGGTGAAGG + Exonic
912665577 1:111576623-111576645 CTGCTCCTCTGGAAGGGTGAGGG + Intronic
913364070 1:118016114-118016136 CTGCCTCTGGAGGAGGGTCATGG + Exonic
916089868 1:161299514-161299536 CTGCTCCTCTAGGAGGGCACAGG + Intergenic
916683654 1:167126144-167126166 CTCCTCGTCTATGAGGGTGAGGG - Exonic
920646016 1:207804982-207805004 CTGCCATCCAAGGAGGGTGATGG + Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922960724 1:229643701-229643723 CTGCCACACAAGGAGGGAGAAGG - Intronic
923054491 1:230415703-230415725 CTGCACCTCTTGGAGTGAGATGG - Intronic
923229561 1:231972320-231972342 CTGCCCCTCTGGCAGGCAGAAGG - Intronic
924040802 1:239981908-239981930 CTGCCCCTCATGGAAGGAGATGG - Intergenic
1065224372 10:23528060-23528082 CTGCTCCTATAGGAGGGAAAAGG - Intergenic
1065924170 10:30421243-30421265 CTGCCCCTCAAGACAGGTGACGG + Intergenic
1067348217 10:45453714-45453736 CTGCCCCTGTAAGAAGGTGAGGG - Intergenic
1068157989 10:53225187-53225209 TTGCCCATCTAGGAGGGTTGAGG + Intergenic
1068548951 10:58385169-58385191 CTGCCGGGCCAGGAGGGTGATGG - Exonic
1070762800 10:79035229-79035251 CAGCCACTCTAGGATGGTGTAGG - Intergenic
1074437075 10:113443393-113443415 CTGCCTCTCTAGGAGGATCCTGG - Intergenic
1075529369 10:123214937-123214959 CAGCCCCTTTAAGAAGGTGAGGG + Intergenic
1075664271 10:124219641-124219663 CTGTCCCCGTAGGAGGGTCAAGG - Intergenic
1077955438 11:7014611-7014633 CTGCCCCTTTAGGAGAGGGGTGG + Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1084689868 11:70718832-70718854 CTGCCTCTCCAGGGGGATGAAGG - Intronic
1085044748 11:73346389-73346411 CTTCCTCTGTAGCAGGGTGATGG + Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1089674261 11:120079534-120079556 CTCCCTCTCTAGGAGGAGGAAGG - Intergenic
1089896657 11:121936797-121936819 GTGCCGCTCTGGGAGGGTGTGGG + Intergenic
1092070032 12:5624720-5624742 CTCCCAGTCTAGAAGGGTGAGGG + Intronic
1093371915 12:18376016-18376038 CTGCCCCTGTAGCAGGCTTATGG - Intronic
1095799890 12:46260870-46260892 CTGCCTCTATAGGTGGGAGAGGG - Intronic
1096996373 12:55840743-55840765 CTGCACCTCTTGGAAGGTCAAGG + Exonic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1101939325 12:109088355-109088377 AAGCCCCTCCAGGAGGGTGGCGG - Exonic
1102576179 12:113857519-113857541 CTGCCCCGCTGTGAGGGTGAGGG + Intronic
1103403653 12:120659941-120659963 CTAGCCCTCTAGGAAGGTGTGGG + Intronic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1106101255 13:26696360-26696382 CTGCCCCTCTAGGCGGGGTCAGG - Intergenic
1106193961 13:27477351-27477373 CTGCCCCTGGAGGCCGGTGACGG - Intergenic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1107428459 13:40317121-40317143 CTGCCCCTTTAGGAGCCTGGAGG + Intergenic
1107835044 13:44406170-44406192 CTGCTCCAGAAGGAGGGTGAAGG - Intergenic
1108314023 13:49220674-49220696 CTGTCCCTCTACGTGGGCGAGGG + Exonic
1108933930 13:55864270-55864292 CTGGCCCTCCAGGACTGTGATGG - Intergenic
1111084265 13:83352990-83353012 CTGGGCCTTTTGGAGGGTGAAGG + Intergenic
1113013863 13:105805146-105805168 CTGTCCCTCTAGATGGGGGAAGG + Intergenic
1114233619 14:20805042-20805064 CCAGCCCTCTAGGAGGGTAAAGG - Intergenic
1115188616 14:30721747-30721769 CCACCCCTCTAAGAAGGTGAAGG + Intronic
1117052659 14:51877133-51877155 CTGGCCCTTTAGGAGGGTGGAGG - Intronic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1123997723 15:25730377-25730399 CTGCCTCTCTAGGAGGGAGCAGG - Intronic
1124150609 15:27174869-27174891 CTGCCCCTCTCAGAGGGGAATGG + Intronic
1128094286 15:64942259-64942281 CTGATCCTCTAGATGGGTGAGGG - Intronic
1128338521 15:66803605-66803627 CTGCCCCACAAGGAGCCTGAAGG - Intergenic
1128604746 15:69028267-69028289 CTGCAGCTCCTGGAGGGTGATGG - Exonic
1132372403 15:101307851-101307873 CTGCCCCTCTCGGACGGTCCTGG + Intronic
1132502715 16:291707-291729 CTGCACCTCAGGGAGGCTGAGGG + Intronic
1132508373 16:324137-324159 CTGCCCCTCATGGAGGCTGCTGG - Intronic
1132670242 16:1099570-1099592 CTGCCCCTCTGGGAGGGGCCAGG + Intergenic
1132761625 16:1511231-1511253 CTGCCCCTGGAGGCGGGTGGGGG + Intronic
1134673493 16:16073175-16073197 GTACCCCTGGAGGAGGGTGATGG + Intronic
1135126887 16:19818104-19818126 CTTCGCCTCTAGGAGGGTTTGGG + Intronic
1139325047 16:66146025-66146047 CTGCCCCTCTTGGAAGGGGATGG + Intergenic
1141676722 16:85521691-85521713 CTGCTCCTCCAGGCGGGAGATGG - Intergenic
1141909047 16:87046106-87046128 CTGCCCCACCATGAGTGTGAGGG + Intergenic
1142415071 16:89936732-89936754 CTGTCCCTGTAGGAGGATGTGGG - Intergenic
1142687010 17:1583193-1583215 CTGCCTCTCCAGGTGGGTGTGGG - Exonic
1143659293 17:8314949-8314971 CTGCCCCTGCAGGATGGTGAGGG + Exonic
1144848826 17:18233885-18233907 CTGCCCCTCGAGCAGGGTCAGGG - Exonic
1145267550 17:21387619-21387641 CTTCCCCTGTCGGAGGGTGTGGG + Intronic
1147635359 17:41960686-41960708 TTGCCAATCCAGGAGGGTGAGGG - Intronic
1149569749 17:57663943-57663965 CTCTCCCCCTAGGAGGGAGAAGG - Intronic
1152362329 17:79838563-79838585 CTGCACCACTAGGAGGGAGAAGG + Intronic
1152660815 17:81541124-81541146 CAGCCCCTCAAGTAGGATGAGGG + Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155047362 18:22114520-22114542 CTGCCCAGCAAGGAAGGTGAAGG + Intergenic
1155342356 18:24825740-24825762 AAGCCCCTCTAAGAGGGTGTGGG + Intergenic
1156355416 18:36336177-36336199 GTGCACCTCTATGAGGATGATGG + Intronic
1156492832 18:37506431-37506453 CTGCCCCTCCAAGAGGGGGCTGG + Intronic
1157382838 18:47235473-47235495 CTGCTCATCCAGGAGGGTGGAGG + Intronic
1159957908 18:74532831-74532853 CTGCCCCTCTGCAAGGGAGAGGG + Intergenic
1160199867 18:76787554-76787576 CCGCCCCTCCAGGATGGCGAAGG + Intergenic
1160846380 19:1167970-1167992 CTGCCCCACTTGGAGGATGTGGG - Intronic
1160970713 19:1766616-1766638 GGTCCCCTCTTGGAGGGTGATGG + Intronic
1161201075 19:3015169-3015191 CTGCCCCTGTAGGTGGGAGAAGG + Intronic
1163827263 19:19530567-19530589 CTGCCCCCGCAGGAGGGTGCAGG - Intronic
1166385610 19:42378902-42378924 CTGCCCCTCTTAAAGGGGGAAGG + Intergenic
1166531971 19:43548135-43548157 CCGCCCCTCCAGGAGGGAGGTGG + Intronic
1167777492 19:51569789-51569811 CTGCCCCACTAAGAGTATGAGGG + Intergenic
1168152379 19:54456027-54456049 CTGCCCCTCTAGGAGGGTGAAGG - Exonic
925200777 2:1966068-1966090 ATGCCCCTCTAGGGGTGTCAGGG - Intronic
928175787 2:29033547-29033569 CTGCCCATCAAGGAGGGGTATGG + Exonic
929540759 2:42818818-42818840 ATGCCCCTTTGGGAGGCTGATGG + Intergenic
930104941 2:47632229-47632251 CAGCCTCTCTAGGAGAGGGAAGG + Intergenic
930538243 2:52670972-52670994 AGGCCCCTCTGGTAGGGTGAGGG + Intergenic
930673088 2:54171962-54171984 CTACCACTTTAGGAGGTTGAGGG + Intronic
932454830 2:71842797-71842819 CTGCCCATCAAGGATGATGAGGG + Intergenic
932563481 2:72891606-72891628 CTGCCCCTATGGCAGGGTGTGGG - Exonic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933708788 2:85310158-85310180 CTGCCACTCTGGGATTGTGAAGG - Exonic
934936857 2:98472009-98472031 GTGCCCCACAAGGAGGGTGTAGG + Intronic
935238812 2:101160728-101160750 ATGCCATTCTAGGAGGGGGAGGG + Intronic
935704193 2:105841611-105841633 CTCCCCTTCTTGGAGGGTGGAGG + Intronic
937032955 2:118756075-118756097 CAGCATCTCTAGGATGGTGATGG - Intergenic
942605882 2:177690195-177690217 CAGCCCCTGTAGTAGGTTGATGG - Intronic
943874275 2:193043096-193043118 CTGCTCCTCTAAGATGATGAAGG + Intergenic
944611487 2:201413342-201413364 CTGCCCCTCCTGGAAGGAGAGGG - Intronic
947543765 2:230996161-230996183 CGGCCCCTCCAGGAGGGAGCCGG + Exonic
947624815 2:231612900-231612922 CTGCCCCACTGGGAGGGAGAAGG + Intergenic
948265285 2:236631657-236631679 CTGCCCCTCGGTGAGGATGAAGG + Intergenic
949071870 2:242030226-242030248 CTGCCCTTCAAGGGGGGTGTGGG + Intergenic
1172780106 20:37431531-37431553 CTGCCCTTCAAGATGGGTGATGG + Intergenic
1172849064 20:37947566-37947588 AGGTCCCTCTAGGAGGGTGTGGG + Intergenic
1173624981 20:44466041-44466063 CTGCCCCTCCAGGAGGCTCTAGG + Intergenic
1173874323 20:46360396-46360418 TGGACCCTCTAGGAGTGTGATGG - Intronic
1175868172 20:62192552-62192574 CTGCCCTTTTTGGAGGGTGGGGG + Intronic
1176115112 20:63428791-63428813 CTGTCCCTCTAGGATGTTCAGGG - Intronic
1176229478 20:64024682-64024704 CTGGCCTTCCAGGTGGGTGAGGG + Exonic
1178879882 21:36441020-36441042 CTGGGCCTGTGGGAGGGTGAGGG - Intergenic
1180183227 21:46127196-46127218 CGTCCCCTCCAGGAGTGTGAGGG + Intronic
1181314848 22:21964408-21964430 CGGCCCCTCCTGGAGGGTGACGG + Intronic
1182502181 22:30755740-30755762 TTGCCCCTCTTGGAGGGTGGGGG - Intronic
1182622118 22:31623965-31623987 CTGCCTCTCCATGGGGGTGATGG + Intronic
1182881596 22:33738536-33738558 CTGCCCAACCAGGAGGCTGAGGG - Intronic
1183086327 22:35489441-35489463 CTGGCCCTTAGGGAGGGTGATGG - Intergenic
1183661478 22:39224056-39224078 CTGCCCTTCCAGGTGGGTGTGGG - Exonic
1183694828 22:39415765-39415787 CTGCTCCTCTACTGGGGTGAAGG - Intronic
1184243885 22:43226349-43226371 CTGCGGCTCTGGGTGGGTGATGG + Intronic
1184649853 22:45914766-45914788 CAGACACTCTGGGAGGGTGAGGG - Intergenic
1184851347 22:47123083-47123105 CAGCCCCTCCAGGAGGCTGAGGG + Intronic
1185223884 22:49642376-49642398 CTGGCCCTATAGGAGGCTGGAGG - Intronic
1185421217 22:50735401-50735423 CTGCTCCTCACGGAGGGTGGTGG + Intergenic
954714903 3:52522123-52522145 CTGCCCGACTACGAGGGTGATGG + Exonic
956262639 3:67361868-67361890 TTGCTCCTCTGGGATGGTGAGGG + Intronic
962964276 3:140338987-140339009 CTGCTCCACTAGGAGGGAGTAGG + Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965416949 3:168407751-168407773 CTCACCCTGTATGAGGGTGAAGG - Intergenic
965888012 3:173472889-173472911 CTGCCCCTTTAGGAGTCTGTTGG + Intronic
966242964 3:177775035-177775057 CTGCCACTCTAGGAGGGTGATGG - Intergenic
967844396 3:194032602-194032624 CTGCCCCTGGAGGAGGGAGGGGG - Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
971812472 4:31444516-31444538 CTGGCTCTCTGGCAGGGTGAGGG + Intergenic
973970362 4:56207398-56207420 CTGCCTATCCAGGAGAGTGAAGG + Intronic
976188941 4:82470611-82470633 CTGCCTGTGGAGGAGGGTGAAGG - Intergenic
978903487 4:113979941-113979963 CTTTCCCTCTAGCGGGGTGATGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
981616503 4:146648887-146648909 CAGACCCTATGGGAGGGTGAGGG - Intergenic
985480350 5:106670-106692 CTCCCCCTGCAGCAGGGTGAGGG + Intergenic
987850113 5:23340874-23340896 CTGGCCCTGTTGGAGGGTGGAGG + Intergenic
989045358 5:37268703-37268725 CTGCCTCACTGGTAGGGTGAGGG - Intergenic
990730226 5:58800638-58800660 CTGCCACACGTGGAGGGTGAAGG + Intronic
991861071 5:71013743-71013765 CTGCCCCTCAGGGATGGTCATGG - Intronic
992491374 5:77247730-77247752 CTGGCCCTCAGGGAGGGGGAAGG - Intronic
993242779 5:85412462-85412484 CTGCCCATTTAGTATGGTGATGG + Intergenic
997184363 5:131866631-131866653 TTGCCCCTCTGTGGGGGTGAGGG + Intronic
999290182 5:150419855-150419877 TTGTCCCTCAAGGAGGGGGACGG - Intergenic
1001401474 5:171448931-171448953 CTGCCCCTCAGGCAGGGAGATGG - Intronic
1001420012 5:171579132-171579154 CTGCCCCTCTAGTGAGGTGTGGG + Intergenic
1004195724 6:13502931-13502953 CTCCACCTCTACCAGGGTGAAGG - Intergenic
1005597045 6:27389331-27389353 CTTCCCCTCTAGCTGGGCGAGGG + Intronic
1006299521 6:33186143-33186165 CTGCCCCTCCAGGTAGGTGGGGG + Intronic
1006387160 6:33737678-33737700 GTGCCTCTATAGGAGGGAGAAGG + Intronic
1008054983 6:46936762-46936784 CTTGTCCTCTGGGAGGGTGATGG + Intronic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1009458272 6:63882399-63882421 CTGCCCCTCATGGAGGCTTATGG - Intronic
1010001685 6:70955804-70955826 CTGCCCCGCTGGGTGGGCGAGGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1014472635 6:121835213-121835235 TTACCCCTTCAGGAGGGTGACGG - Intergenic
1016761166 6:147739079-147739101 CTGCCTGTCTAGGATGGTGTTGG + Intergenic
1017734198 6:157346121-157346143 CTGCCTCTCTAGGAGGGTCAGGG + Intergenic
1017913305 6:158813536-158813558 CTGCCCCTCGTGGAGGAGGAGGG + Intronic
1018435272 6:163753317-163753339 CAGCCCCTCTAGAGGGCTGAGGG + Intergenic
1018869178 6:167768619-167768641 CTGCGTCTCAAGGAGGGAGAGGG - Intergenic
1018899536 6:168044234-168044256 CTGACCCTCCCGGAGGGTGAGGG + Intronic
1018899560 6:168044317-168044339 CTGACCCTCCCGGAGGGTGAGGG + Intronic
1018899635 6:168044572-168044594 CTGACCCTCCCGGAGGGTGAGGG + Intronic
1018962435 6:168458213-168458235 CAGCCTCTCTGGGAGGGAGACGG + Intronic
1019657923 7:2207417-2207439 CTCCCCTCCTAGGAGGTTGAGGG - Intronic
1019927081 7:4200316-4200338 CAGCTCCTCTAGGAAGGTGCCGG - Intronic
1021884566 7:25125791-25125813 CTGTCCCTCTAGGATGCTGTTGG - Intergenic
1025108202 7:56190679-56190701 CTGGCCCTCCAAGAGGGAGATGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1029524245 7:101085534-101085556 CTTGACCTCTAGGATGGTGAGGG - Exonic
1031980423 7:128121120-128121142 CTGCCCCTCTGGCTGGGAGAGGG + Intergenic
1032130780 7:129225454-129225476 CTGCCTCTCTAGGAGAGGAAGGG + Intronic
1033014856 7:137661593-137661615 CTTCCCATCTAGGAGGCTAAGGG - Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034330389 7:150277655-150277677 CTGCTTATCTAGGAGGGTGGGGG - Intronic
1034667654 7:152832193-152832215 CTGCTTATCTAGGAGGGTGGGGG + Intronic
1035386606 7:158477162-158477184 CAGCCCCTCTGAGAGGATGAAGG + Intronic
1035751192 8:1997577-1997599 CCGCCCCTCTAGGAGGCTCTGGG - Intronic
1035754378 8:2020868-2020890 CTGCCCCGCTAGGAGAGTCCCGG - Intergenic
1035930821 8:3777914-3777936 CTGCCCTTCAAGGAGGCTGCGGG - Intronic
1038617934 8:29112646-29112668 CATCCCCTCTTTGAGGGTGAGGG + Intronic
1039250307 8:35656620-35656642 CAGCCCCTCAAAGAGGGTTAAGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1044324248 8:90842022-90842044 CTGGGCCTGTGGGAGGGTGAGGG + Intronic
1044751587 8:95421779-95421801 GTGCCCAGCCAGGAGGGTGATGG + Intergenic
1045063491 8:98427047-98427069 CTGCCTCTCTGGGTGGGTGAGGG + Exonic
1045466835 8:102477908-102477930 CTGCCTCTCAAGGTGGGTTATGG - Intergenic
1046115836 8:109781951-109781973 TTCCCCCTCTAGGAGGCTGATGG - Intergenic
1048215719 8:132492881-132492903 CTTACCCTCTAGGAAGATGATGG + Intergenic
1049104592 8:140603965-140603987 CTGCCCCTCCCTCAGGGTGAAGG + Intronic
1049209251 8:141377777-141377799 CTGCCCCTGAAGGAGGGTCTGGG - Intergenic
1049268881 8:141683805-141683827 CTGCTCCTCTGGGAAGGAGAAGG - Intergenic
1049654323 8:143791155-143791177 CTGCTCCTCTAGGAGGGCACAGG + Exonic
1049681707 8:143921622-143921644 CTGCGCCTCCAGCAGGATGAGGG + Exonic
1050886905 9:10778269-10778291 CTGCCCATCTAGCAGCATGATGG - Intergenic
1052971244 9:34378432-34378454 CTGCCCCTCAGGGAGCGAGAAGG - Intergenic
1053468125 9:38325068-38325090 CCGCCCTTCCAGGAGGGTGGTGG + Intergenic
1054951678 9:70858911-70858933 CTGCCTCTCCAGGATGGGGAAGG + Intronic
1056233947 9:84573273-84573295 CTGCCCCACTTTGAGGCTGAGGG + Intergenic
1056702804 9:88924934-88924956 CTGACCCTCCAGGCTGGTGATGG - Intergenic
1060230303 9:121820888-121820910 CGGCCCCTCTAGGCTGGGGAAGG + Intergenic
1060883187 9:127133132-127133154 CTGCCCCTCTGTGAAGGTGGTGG - Intronic
1061666800 9:132164779-132164801 CTGCCCCTCTCTCTGGGTGAAGG - Intronic
1061680817 9:132241709-132241731 CGTCCCCCCTCGGAGGGTGACGG - Intronic
1061952780 9:133945597-133945619 CTGCCCCACCAGGAAGGTCAGGG + Intronic
1062200917 9:135302163-135302185 CTGAGCCCCCAGGAGGGTGAGGG - Intergenic
1185943955 X:4353637-4353659 CAGCCCCTCAAGGGGGTTGAGGG + Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187814557 X:23216973-23216995 CTGCCCCCATAGGAGGTTGGAGG - Intergenic
1191778524 X:64843973-64843995 CTTCCCCTCCAGGAGGTTGCAGG + Intergenic
1193743424 X:85244795-85244817 CTGCCCCGCTACGTGGGAGACGG - Intronic
1193826511 X:86233176-86233198 CTGGGTCTATAGGAGGGTGAAGG + Intronic
1194659390 X:96612952-96612974 TGACCCCTCTTGGAGGGTGATGG - Intergenic
1196942830 X:120794481-120794503 CAGCCCCTCCAGGAGAGGGAGGG + Intergenic
1197418591 X:126207951-126207973 CTGGACCTATAGGAGGGAGAAGG + Intergenic
1197997233 X:132390514-132390536 CTGCCTCTCTAGGATATTGAGGG + Intronic
1198532508 X:137560162-137560184 CTGGAAATCTAGGAGGGTGATGG + Intergenic
1200230578 X:154441958-154441980 CTTTCCCTCTGGGAGGGTGGCGG + Intronic
1200725459 Y:6664407-6664429 CAGCCCCTCTAGGGGGGCAAAGG + Intergenic