ID: 1168153483

View in Genome Browser
Species Human (GRCh38)
Location 19:54461066-54461088
Sequence CAGACTCCCCGGTGGGAAAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168153483_1168153490 23 Left 1168153483 19:54461066-54461088 CCGTTTTCCCACCGGGGAGTCTG 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1168153490 19:54461112-54461134 ATTTTTTGCCTCAGAGGGATGGG 0: 1
1: 0
2: 1
3: 16
4: 198
1168153483_1168153493 30 Left 1168153483 19:54461066-54461088 CCGTTTTCCCACCGGGGAGTCTG 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1168153493 19:54461119-54461141 GCCTCAGAGGGATGGGATTGGGG 0: 1
1: 0
2: 1
3: 26
4: 287
1168153483_1168153487 17 Left 1168153483 19:54461066-54461088 CCGTTTTCCCACCGGGGAGTCTG 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1168153487 19:54461106-54461128 GTTTTTATTTTTTGCCTCAGAGG 0: 1
1: 0
2: 9
3: 95
4: 990
1168153483_1168153488 18 Left 1168153483 19:54461066-54461088 CCGTTTTCCCACCGGGGAGTCTG 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1168153488 19:54461107-54461129 TTTTTATTTTTTGCCTCAGAGGG 0: 1
1: 0
2: 23
3: 1032
4: 7552
1168153483_1168153492 29 Left 1168153483 19:54461066-54461088 CCGTTTTCCCACCGGGGAGTCTG 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1168153492 19:54461118-54461140 TGCCTCAGAGGGATGGGATTGGG 0: 1
1: 0
2: 0
3: 18
4: 210
1168153483_1168153489 22 Left 1168153483 19:54461066-54461088 CCGTTTTCCCACCGGGGAGTCTG 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1168153489 19:54461111-54461133 TATTTTTTGCCTCAGAGGGATGG 0: 1
1: 0
2: 3
3: 22
4: 259
1168153483_1168153491 28 Left 1168153483 19:54461066-54461088 CCGTTTTCCCACCGGGGAGTCTG 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1168153491 19:54461117-54461139 TTGCCTCAGAGGGATGGGATTGG 0: 1
1: 0
2: 4
3: 14
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168153483 Original CRISPR CAGACTCCCCGGTGGGAAAA CGG (reversed) Exonic
900004235 1:34177-34199 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
900023963 1:204693-204715 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
902818171 1:18927795-18927817 CAGGCTCCCCGGTGGGGTCAGGG + Intronic
903302355 1:22388556-22388578 CAGTCTCCACGCTGGTAAAATGG - Intergenic
905179089 1:36155794-36155816 CAAACTCCAGGGTGGGAAAGGGG + Intronic
907448074 1:54522279-54522301 CAGTCTCCCTGGTGGGGAAAGGG + Intergenic
907892514 1:58649176-58649198 CAGAGTCTCAGGTGGGAAGAAGG - Intergenic
910032656 1:82748790-82748812 GAGATTCCCTGGTGGGGAAAAGG - Intergenic
912050332 1:105521634-105521656 CACACCCCCAGGTGGGACAAAGG - Intergenic
912523743 1:110265658-110265680 CAGGCTCCCTGGTGCTAAAATGG - Intronic
913501588 1:119477061-119477083 CAAAGACCCAGGTGGGAAAAGGG + Intergenic
917239321 1:172930394-172930416 AAGACTTCCCTGTGGGCAAAAGG + Intergenic
919268142 1:195300849-195300871 CTGATTTCCTGGTGGGAAAAAGG + Intergenic
919750217 1:201033145-201033167 GAGACTCCATGGTGGGAAGAAGG - Intergenic
921047634 1:211488805-211488827 CAGACTCCACGGAGGGAATATGG - Intronic
922768819 1:228170986-228171008 CAGAAGCCCCGGTGGGAGCAAGG - Intronic
923136503 1:231124738-231124760 CAGAGTCCCAGGTTGGAAACAGG - Intergenic
924166483 1:241288583-241288605 CAGACACCCCAGATGGAAAAAGG + Intronic
1063984425 10:11486837-11486859 CAGACTTTCTGGGGGGAAAATGG - Intronic
1064863592 10:19854048-19854070 CAGTCTCCCCGGGGGGTCAAGGG - Intronic
1066477891 10:35765315-35765337 CAGGCTGCACGGTGGGAAGACGG - Intergenic
1066620679 10:37345792-37345814 ATGATTCCCCGGTGAGAAAATGG + Intronic
1068139275 10:52984265-52984287 AAGATTCCCCTGTAGGAAAATGG - Intergenic
1068919701 10:62470268-62470290 CAGACTCCCAGGGGTGATAATGG - Intronic
1073275611 10:102307819-102307841 CAGATTTCCCAGTAGGAAAATGG + Intronic
1075726402 10:124613016-124613038 CAGGCTCCCCAGTGGGAGACAGG + Intronic
1089641136 11:119847980-119848002 CAGCTTCCCAGGTGGGCAAAGGG - Intergenic
1090165095 11:124538085-124538107 CAGATTCCCCAGTGAGAACAGGG - Intergenic
1090420580 11:126572548-126572570 CAGAGACCCCAGTGGGAAGAGGG + Intronic
1091314279 11:134600315-134600337 AAGTCTCCCCTGTGGGAAAGGGG - Intergenic
1091377659 12:36225-36247 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
1091675853 12:2488761-2488783 CAGAGTCCCTGCTGGGAAGAGGG + Intronic
1095496639 12:42791366-42791388 CAGTATCCCAGGTGGTAAAATGG - Intergenic
1101718486 12:107331658-107331680 CAGACTTCCGGGTGGGAAGGAGG - Intronic
1102653478 12:114460608-114460630 ATGACTGCCCAGTGGGAAAATGG + Intergenic
1105679881 13:22715187-22715209 AAGACTACCCAGTGGTAAAAAGG - Intergenic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1107741786 13:43458248-43458270 TAAACTCCCCGATAGGAAAATGG + Intronic
1113411215 13:110091651-110091673 CAAACTCCTCTGTGGGCAAATGG - Intergenic
1116902335 14:50373284-50373306 AAGACGACCCAGTGGGAAAATGG + Intronic
1118380833 14:65216380-65216402 CAGACTATCTGGGGGGAAAAGGG + Intergenic
1118633179 14:67724635-67724657 CAGAGGCCCCAGTGGGAAGAAGG - Intronic
1120825207 14:88948827-88948849 CAGACTGTGGGGTGGGAAAATGG - Intergenic
1122056889 14:99105133-99105155 CAGAGTCCCCGGAGAGAAGAGGG + Intergenic
1122719225 14:103712866-103712888 CAGACTCACCGGTTGGCCAACGG + Intronic
1125575270 15:40751033-40751055 AAGGCTCCCCTGTGGGAAGAGGG + Intronic
1128233485 15:66051449-66051471 CAGACTTCTCTGTTGGAAAAGGG - Intronic
1129698843 15:77755959-77755981 CTGACTCCTCGGTGGGAGCAGGG + Intronic
1132449269 15:101956767-101956789 CAGAGTCCCAGGTGGGAAGAAGG - Intergenic
1140113926 16:72025696-72025718 CTGTCTCCACGGTGGGAAATGGG - Intronic
1140756953 16:78076272-78076294 CAGACTTCCCTGTTGGGAAATGG - Intergenic
1142017070 16:87755141-87755163 CAGACTCCCACGTGGGAAGAGGG + Intronic
1143103878 17:4518965-4518987 CAGACTTCCCGGTGGAAGGACGG - Intronic
1143746156 17:8995722-8995744 CAGACTCCCTGGCCTGAAAAGGG - Intergenic
1148335904 17:46841365-46841387 GAGGCTTCCCGGTGGGAAGAAGG + Intronic
1148383090 17:47214328-47214350 CAGACTTCATGGTGGGAAGAGGG - Intronic
1160635987 19:75786-75808 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
1161190129 19:2950057-2950079 CAGACCCTCCGGCCGGAAAAGGG - Intergenic
1161898605 19:7100961-7100983 CAGAGTCTCTGTTGGGAAAAGGG - Intergenic
1163131093 19:15273466-15273488 AAAACTCACAGGTGGGAAAAGGG - Intronic
1163823727 19:19511182-19511204 CAGACTCCCCACTTGGAAAATGG - Intergenic
1166187009 19:41146797-41146819 CAGTTTCCCCAGTGGTAAAATGG - Intergenic
1168153483 19:54461066-54461088 CAGACTCCCCGGTGGGAAAACGG - Exonic
926740067 2:16103211-16103233 CAGACTGCACGGTGAGACAACGG + Intergenic
926765114 2:16317526-16317548 TAGACTCCCAGGTGGGATCAAGG + Intergenic
930859232 2:56052605-56052627 AAGACTCCCAGCTGGCAAAAAGG - Intergenic
932264805 2:70358432-70358454 CAGACTCTCCTGTGGGCAGAAGG + Intergenic
935330152 2:101971251-101971273 CAGACTCCCTGGAGGAAAAATGG - Intergenic
936565493 2:113579266-113579288 CAGAGTCCCAGGTGGGAAGAAGG - Intergenic
937973923 2:127569777-127569799 CAGACTCGCCGCTGCAAAAAGGG - Exonic
948547314 2:238742109-238742131 CAGATTCACAGGAGGGAAAATGG + Intergenic
1172329166 20:34062700-34062722 CTGACTTCCCTGTGGGAAAGAGG + Intronic
1175639889 20:60620145-60620167 CAGTCTCCCGGGTGGGACAGAGG - Intergenic
1183407612 22:37638233-37638255 CAGCCTTCCTGTTGGGAAAAGGG + Intronic
1184144336 22:42600023-42600045 CATACTGCCCACTGGGAAAAAGG - Intronic
1184381569 22:44147982-44148004 CAAACGCCCCGCTGGGAAGAAGG + Intronic
1184596216 22:45515796-45515818 CAGCTTCCCCAGTGGGAAAACGG - Intronic
1184783864 22:46662438-46662460 CAGCCTCCACGGCGGGAAACCGG - Intronic
1184998533 22:48227680-48227702 CAGGCTCCCCTAGGGGAAAAAGG - Intergenic
951387900 3:22064780-22064802 CAGAGTCCTGGGTGGGAAAAGGG + Intronic
952951888 3:38532388-38532410 CAGTCACCCTGGTGGGAAGATGG + Intronic
953843457 3:46408054-46408076 CAGACTGCCCTGTGGAGAAATGG - Exonic
954649826 3:52154300-52154322 CAGTCTCCCCGCTGGGACACTGG - Intronic
956720706 3:72115125-72115147 CAATCACCCCGGTGGGAAAGGGG - Intergenic
957118709 3:76060883-76060905 CAAATTCCACGGTGGGAACAGGG - Intronic
960726231 3:120673085-120673107 CAAAATCTCCAGTGGGAAAATGG - Intronic
961829834 3:129617812-129617834 CAGACTTGCAGATGGGAAAAAGG - Intergenic
962126557 3:132625159-132625181 TGGACTCCACTGTGGGAAAATGG + Intronic
964301233 3:155287684-155287706 CAGAGTCACCGGGAGGAAAAAGG + Intergenic
964731536 3:159872012-159872034 CAGCCTCCCCTGTGGGCACATGG + Intronic
965350067 3:167600361-167600383 CAGACACTGTGGTGGGAAAAGGG + Intronic
966160151 3:176959207-176959229 CAGACTCACTTCTGGGAAAAGGG + Intergenic
968781473 4:2585409-2585431 CAGCCTCTCTGGTGGGTAAATGG + Intronic
971331938 4:25688847-25688869 CAGAGTCCCCAGTGGCAAGAGGG + Intergenic
972281105 4:37602923-37602945 CAAGCTCCCAGGTGAGAAAATGG + Intronic
974806070 4:66882600-66882622 CAGAGTCCTAGGAGGGAAAATGG + Intergenic
978738327 4:112109510-112109532 CAGACACCCCAGTAGAAAAATGG + Intergenic
979567625 4:122173331-122173353 CAGAGTCCCCACTGGTAAAAAGG - Intronic
983279964 4:165667953-165667975 CAGATTCACCAGAGGGAAAAGGG + Intergenic
984568621 4:181362671-181362693 CAGACTCACCAGCAGGAAAAAGG + Intergenic
985913301 5:2899193-2899215 CTGGGTCCACGGTGGGAAAATGG - Intergenic
986468819 5:8053278-8053300 CAGAGTCCCAGGTGGGGCAATGG + Intergenic
990516400 5:56534780-56534802 CAAACTCCCCTCTGGGAATATGG - Intronic
990537250 5:56734760-56734782 CAAACTCCCGGGTTGGGAAAAGG - Intergenic
997965465 5:138352809-138352831 CGGCCTCCCCGGTGGGCAAGCGG + Exonic
999282042 5:150372372-150372394 AAGACTCCCCTGTGGGAAGCAGG - Intronic
1000825278 5:166037208-166037230 TAGACACCCTGGTGGAAAAATGG - Intergenic
1001020395 5:168178004-168178026 CAGACTGCCAGCTGGGAGAAGGG - Intronic
1001995456 5:176153838-176153860 GATACTCCCCGGTGAGAATAAGG + Intergenic
1004428411 6:15522310-15522332 CAGACTCCCCGCCGGGATGAGGG - Intergenic
1005825860 6:29631655-29631677 CAGGCTCCCCAGTGGGAGGAAGG + Intronic
1006295545 6:33168545-33168567 CATTCTCCCCGGTGGGACCAGGG + Exonic
1009291466 6:61888329-61888351 CATATCCCCAGGTGGGAAAATGG - Intronic
1014582545 6:123156868-123156890 CAGAATTCCAGCTGGGAAAAAGG - Intergenic
1016360703 6:143264628-143264650 GAGACTCCCCAGTTGGAAATTGG + Intronic
1021776997 7:24063932-24063954 CAGCCTACCCAGTGAGAAAATGG - Intergenic
1022555649 7:31292961-31292983 CAAACTCCCATGTGTGAAAATGG + Intergenic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1035112902 7:156498056-156498078 CAGATTGCCCGGTGGGAAGGGGG + Intergenic
1040907740 8:52486176-52486198 CAGACTCCTGGCTGGTAAAAGGG + Intergenic
1041377243 8:57216866-57216888 CAGATTCCACGGTGGGTAGACGG + Intergenic
1041648729 8:60280915-60280937 CAGAGACCCCCGTGGGAAAGAGG + Intronic
1044698326 8:94944804-94944826 CAGTCTCACTGTTGGGAAAATGG + Intronic
1048182979 8:132213372-132213394 CAAACTGCCTGGGGGGAAAAAGG + Intronic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1049220655 8:141427371-141427393 CAGACTCCCTGCTGGGAGAACGG + Intronic
1049886932 9:33960-33982 CAGAGTCCCAGGTGGGAAGAAGG + Intergenic
1053195984 9:36118953-36118975 CAGCCTACCCGGTGGGATGATGG - Exonic
1053370873 9:37560672-37560694 CAGAGGCCCCAGTGGTAAAACGG - Intronic
1057064786 9:92038611-92038633 CAGACTCCCTGGTGGGAGGCTGG - Intronic
1060195536 9:121621092-121621114 CAGACTTGCAGGTAGGAAAAAGG - Intronic
1203772770 EBV:57990-58012 CAGACTCCCAAGAGGAAAAAGGG - Intergenic
1186747201 X:12582506-12582528 CAAACTCCCCTGTGGGAGGAGGG + Intronic
1187059951 X:15776485-15776507 TATATTCCCCTGTGGGAAAACGG - Intronic
1196695705 X:118609039-118609061 AATACTCCCCAGTGGGACAAAGG + Intronic
1201485965 Y:14495021-14495043 TAGAGTACCGGGTGGGAAAAAGG + Intergenic