ID: 1168153543

View in Genome Browser
Species Human (GRCh38)
Location 19:54461328-54461350
Sequence CCCGTGCCCGCCTGCGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 175}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168153533_1168153543 12 Left 1168153533 19:54461293-54461315 CCGGGGGGCCAGTGGAAAGAAGA 0: 1
1: 0
2: 3
3: 14
4: 287
Right 1168153543 19:54461328-54461350 CCCGTGCCCGCCTGCGGCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1168153535_1168153543 4 Left 1168153535 19:54461301-54461323 CCAGTGGAAAGAAGACAGGCCGT 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1168153543 19:54461328-54461350 CCCGTGCCCGCCTGCGGCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1168153528_1168153543 23 Left 1168153528 19:54461282-54461304 CCCATCCCATGCCGGGGGGCCAG 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1168153543 19:54461328-54461350 CCCGTGCCCGCCTGCGGCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1168153532_1168153543 17 Left 1168153532 19:54461288-54461310 CCATGCCGGGGGGCCAGTGGAAA 0: 1
1: 0
2: 1
3: 2
4: 81
Right 1168153543 19:54461328-54461350 CCCGTGCCCGCCTGCGGCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1168153525_1168153543 28 Left 1168153525 19:54461277-54461299 CCTGGCCCATCCCATGCCGGGGG 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1168153543 19:54461328-54461350 CCCGTGCCCGCCTGCGGCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1168153531_1168153543 18 Left 1168153531 19:54461287-54461309 CCCATGCCGGGGGGCCAGTGGAA 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1168153543 19:54461328-54461350 CCCGTGCCCGCCTGCGGCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1168153529_1168153543 22 Left 1168153529 19:54461283-54461305 CCATCCCATGCCGGGGGGCCAGT 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1168153543 19:54461328-54461350 CCCGTGCCCGCCTGCGGCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 175
1168153523_1168153543 29 Left 1168153523 19:54461276-54461298 CCCTGGCCCATCCCATGCCGGGG 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1168153543 19:54461328-54461350 CCCGTGCCCGCCTGCGGCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168153543 Original CRISPR CCCGTGCCCGCCTGCGGCGG GGG Exonic