ID: 1168153591

View in Genome Browser
Species Human (GRCh38)
Location 19:54461506-54461528
Sequence CGGTGTGGCGGCGGAGGATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168153591_1168153600 -1 Left 1168153591 19:54461506-54461528 CCAGATCCTCCGCCGCCACACCG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1168153600 19:54461528-54461550 GCACTGAGGACACGCCGGCCGGG 0: 1
1: 0
2: 1
3: 9
4: 133
1168153591_1168153599 -2 Left 1168153591 19:54461506-54461528 CCAGATCCTCCGCCGCCACACCG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1168153599 19:54461527-54461549 CGCACTGAGGACACGCCGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 54
1168153591_1168153597 -6 Left 1168153591 19:54461506-54461528 CCAGATCCTCCGCCGCCACACCG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1168153597 19:54461523-54461545 ACACCGCACTGAGGACACGCCGG 0: 1
1: 0
2: 0
3: 7
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168153591 Original CRISPR CGGTGTGGCGGCGGAGGATC TGG (reversed) Exonic
900398460 1:2462860-2462882 CGGGGTGGTGGGGGTGGATCTGG + Intronic
902206372 1:14871132-14871154 CCGTGTGGTGGTGGAGGGTCTGG - Intronic
903461960 1:23526501-23526523 AGGTGTGGCTGGGGAGGCTCTGG - Intronic
903986968 1:27235150-27235172 CGGGGTGGGGGCGGAGGGTTTGG + Intronic
905198865 1:36302936-36302958 GAGTGTGGAGGTGGAGGATCAGG + Intronic
905363363 1:37435189-37435211 CGGTGGGGCGGGGGAGGTTCAGG + Intergenic
906653817 1:47533585-47533607 GGGGGCGGCGCCGGAGGATCGGG + Intergenic
907440401 1:54475016-54475038 CTGGGAGGCGGCGGAGGAGCCGG - Intergenic
910703572 1:90103052-90103074 GGGTGTGGGGGCGGAGGAAGTGG - Intergenic
910787974 1:91021607-91021629 CGCTGCGGCGTCGGAGGATCCGG - Intronic
911348268 1:96722136-96722158 CGGCTTGGCGGCGGGGGATGGGG + Intronic
912481532 1:109985184-109985206 CTGGGTGGCGGCGGGGGCTCGGG + Intronic
918511987 1:185321807-185321829 CGGTTGGGCGGCGGAGGCTCAGG + Intergenic
919678402 1:200409662-200409684 CTGAGTGGCGGCGGAGGTACCGG - Exonic
922809219 1:228406646-228406668 GGGTGCGGCGGCGCAGGCTCGGG + Exonic
1067701630 10:48577424-48577446 CTGGGTGGCGTCGGAGGATGGGG + Intronic
1073098955 10:100997240-100997262 TGGTGGGGCGGCGGAGGTGCAGG + Intronic
1074815709 10:117139818-117139840 CGGGGTGGCGGCGGAGGCAGGGG - Intergenic
1074843282 10:117375435-117375457 CGGTGTGGCGGCGGCGGCAGCGG + Exonic
1083233498 11:61337869-61337891 CAGTGTGGCTGCGCAGGATGGGG + Intronic
1083426659 11:62591467-62591489 CGCTATGGCGGCGGTGGATTCGG - Exonic
1083698678 11:64459356-64459378 CGGTGTGGCAGATGAGGTTCTGG - Intergenic
1085315002 11:75539490-75539512 CGGTGTGGTGGTGGAGCCTCTGG + Intergenic
1086098317 11:83072180-83072202 CGGTGAGGTGGAGGACGATCTGG + Intergenic
1089494085 11:118899790-118899812 GGGTGTGGGGGTGGAGGCTCCGG - Intronic
1090828408 11:130404070-130404092 CGGAGTAGGGGCTGAGGATCTGG + Intergenic
1096502094 12:52070250-52070272 CGTAGTGGCGGCGGGGGATACGG + Intronic
1097968070 12:65602776-65602798 CCGTGTGGGGGCGGAGGGTGGGG + Intergenic
1100992651 12:100267258-100267280 CGCGGGGGCGGCGGAGGATATGG + Intronic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1116863484 14:50013045-50013067 GGGTCTGGTGGCAGAGGATCAGG - Intergenic
1119172504 14:72545800-72545822 CGGTGAGTCGCCGGAGGGTCAGG + Intronic
1119859134 14:77923997-77924019 GGGTGAGGGGGCTGAGGATCAGG - Intronic
1125152615 15:36550323-36550345 GGGTTTGGTGGCAGAGGATCCGG - Intergenic
1129918145 15:79293337-79293359 CTGTGTGGCTGGGGAGGCTCAGG + Exonic
1131466065 15:92655664-92655686 CGGTGGGTCGGCACAGGATCGGG + Exonic
1132840369 16:1975927-1975949 CCGTGTGGCCGTGGAGGATCTGG - Exonic
1133087095 16:3373346-3373368 CGGTGTGACAGCTGTGGATCTGG + Intronic
1133283103 16:4678126-4678148 CGGGGTGGAGGCGGTGGCTCAGG - Intronic
1134057299 16:11178573-11178595 CGGTGAGGCTGCGGAGGCTGTGG - Exonic
1135745705 16:25014952-25014974 CGGTGTGGCGGAGGAGGCGGCGG + Intronic
1138343773 16:56307645-56307667 GGGTGTGGCCTCAGAGGATCTGG - Intronic
1139919555 16:70450887-70450909 CGGCGTGGCTGGGGAGGCTCAGG + Intergenic
1141652403 16:85400091-85400113 CGGTGTGGCGGCGAAGACGCAGG - Intergenic
1142631584 17:1229416-1229438 CGGGGCGGCGGCGGAGACTCCGG - Intergenic
1143651638 17:8267138-8267160 CTGTGTGGCAGAGGAGGAACGGG + Exonic
1144339741 17:14301673-14301695 CGGCGCGGCGGCGCAGGAGCCGG - Exonic
1144625109 17:16840490-16840512 CGGGGTGGAGGCGGTGTATCAGG - Intergenic
1144881322 17:18432231-18432253 CGGGGTGGAGGCGGTGTATCAGG + Intergenic
1145150910 17:20512155-20512177 CGGGGTGGAGGCGGTGTATCAGG - Intergenic
1145750658 17:27353398-27353420 CGGGGTGGGGCCGGGGGATCCGG + Intergenic
1145999300 17:29121810-29121832 GGGTGTGGGGGAGGAGGCTCAGG - Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1151584911 17:75003137-75003159 CGGGGTGGGGGCGGAGGAGAGGG - Intronic
1152843922 17:82587745-82587767 CGGTGTCGGCGCGGAGGTTCTGG - Intronic
1154356074 18:13624131-13624153 CGGTGCTGAGGCGGAGGAGCCGG + Intronic
1156119110 18:33820601-33820623 AGGTGTGGAGGCGGAGGCACGGG - Intergenic
1156462952 18:37331881-37331903 TGGTGTGGCCGCAGAGGATCTGG + Intronic
1159601188 18:70430333-70430355 CGGGGTCGCGGCCGTGGATCTGG + Intergenic
1160888031 19:1361075-1361097 CAGTCTGGCTGCGGAGGAGCAGG - Intronic
1163651795 19:18522087-18522109 CGGCGTGGCGGCGCTGGAGCCGG - Exonic
1167843417 19:52140106-52140128 CGGAGCCGCGGCGGAGGATGGGG + Intergenic
1168153591 19:54461506-54461528 CGGTGTGGCGGCGGAGGATCTGG - Exonic
927024195 2:19048960-19048982 AGGTGTAGAGGTGGAGGATCTGG - Intergenic
938381050 2:130836875-130836897 CGGGGTGGCGTCGGTGGAGCCGG + Intergenic
940112630 2:150171199-150171221 AGGTGGGGCGGGGGAGGCTCAGG + Intergenic
943662749 2:190576624-190576646 GGGTGGGGCGGGGGGGGATCTGG + Intergenic
944060109 2:195563226-195563248 AGGTGTGGGGGCGGGGGATGGGG - Intergenic
946327875 2:218993977-218993999 CGGGGGCGCGGCGCAGGATCTGG - Intergenic
947418571 2:229921958-229921980 CGGCGCGGCGGCGGCGGCTCCGG + Exonic
1175439673 20:58981610-58981632 GGGTGAGGCGCCGGAGGCTCTGG + Intronic
1175945025 20:62554681-62554703 CGGAGTGGTGGCGGCGGCTCTGG + Intronic
1176169472 20:63690467-63690489 CGGTGTGGGGGTGGCGGAGCGGG + Intronic
1180959235 22:19755240-19755262 GGGGGTGGCGGGGGAGGAGCGGG - Intergenic
1182509778 22:30810630-30810652 AGGTGTGGGGGCGGGGGCTCAGG - Intronic
1183929926 22:41230068-41230090 AGGGGTGGGGGCGGAGGAGCTGG - Intronic
1184110668 22:42392242-42392264 TGGTGAGGCAGGGGAGGATCAGG + Intronic
953171457 3:40511420-40511442 CTGTGTGAGGGCAGAGGATCAGG - Intronic
968556467 4:1248543-1248565 CGGGGTAGCGGCCGGGGATCGGG + Intronic
968598066 4:1495597-1495619 CCGTGCGACGGCCGAGGATCAGG + Intergenic
968775436 4:2536964-2536986 CGGGGCGGCGGCGGCGGCTCGGG + Intronic
969673165 4:8600985-8601007 CGGTCTGGCAGGGGAGGACCAGG - Intronic
970558034 4:17255480-17255502 CAGTGTGGTGGCTGAGAATCAGG - Intergenic
970885609 4:20984610-20984632 TGGCGTGGCGGGGGAGGCTCAGG - Intronic
977401273 4:96535246-96535268 GGGTGTGGAGGGAGAGGATCAGG + Intergenic
980115240 4:128672890-128672912 CACTGTGGCGGGGGAGGCTCAGG - Intergenic
982198379 4:152937250-152937272 AGATGTCGCGGCGGAGGCTCCGG + Intronic
985818646 5:2145299-2145321 CGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818653 5:2145339-2145361 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818666 5:2145419-2145441 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818673 5:2145459-2145481 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818687 5:2145539-2145561 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818694 5:2145579-2145601 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818701 5:2145619-2145641 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818708 5:2145659-2145681 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818717 5:2145700-2145722 TGGTGAGGAGGTGGAGGATCCGG - Intergenic
985818726 5:2145741-2145763 CGGTGAGGAGGTGGAGGATCCGG - Intergenic
985818741 5:2145822-2145844 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818748 5:2145862-2145884 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818755 5:2145902-2145924 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818763 5:2145943-2145965 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818799 5:2146146-2146168 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818805 5:2146186-2146208 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818812 5:2146226-2146248 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818819 5:2146266-2146288 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818826 5:2146306-2146328 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818839 5:2146386-2146408 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818847 5:2146426-2146448 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818862 5:2146507-2146529 CGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818877 5:2146588-2146610 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818903 5:2146750-2146772 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818918 5:2146831-2146853 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818926 5:2146872-2146894 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818933 5:2146912-2146934 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818941 5:2146952-2146974 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
985818949 5:2146992-2147014 TGGTGAGGAGGTGGAGGATCTGG - Intergenic
1001088720 5:168721151-168721173 AGGTTTGGGGGCGGAGTATCTGG + Intronic
1002591276 5:180292620-180292642 CGCTGCGGCGCCGGAGGAACGGG + Intergenic
1004906236 6:20239286-20239308 CGGAGTGGCGGGGGAGGCGCAGG - Intergenic
1006910091 6:37558039-37558061 TGGTTTGGTGGCAGAGGATCGGG - Intergenic
1007626068 6:43247063-43247085 CAGTGTGGCGGAGGAGGAAGAGG + Intronic
1010690958 6:78910658-78910680 TGGAGTGGCGGCGGATGACCCGG + Intronic
1014078368 6:117263526-117263548 GGGTGTGGCCCCGGAGGGTCCGG - Intergenic
1014280838 6:119441269-119441291 CGGTGGGGCCGGGGAGGCTCAGG - Intergenic
1014755883 6:125301782-125301804 CTGTGGGGCGGCGGAGCTTCCGG - Intronic
1019343560 7:519435-519457 CGGTGTGGCGGCGGCGGCGGCGG - Intronic
1019534979 7:1524042-1524064 CGGTGTGGCAGCCGGGGCTCTGG - Intergenic
1024691312 7:51806098-51806120 CCGGGTGGCGGGGGAGGCTCAGG - Intergenic
1035032540 7:155870713-155870735 CGGTGGGGCGGGGCAGGATAGGG + Intergenic
1036638055 8:10564946-10564968 CGGTGGGGCGGTGGCGGATGGGG + Intergenic
1045306010 8:100957243-100957265 CGGTGGGGCGGGGGAGGCTCAGG + Intergenic
1048994629 8:139786415-139786437 CGGTGGGGAGGCGGAGGAACTGG + Intronic
1049071640 8:140359805-140359827 GAGTGTGGCGGCCGAGGAGCAGG + Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049337596 8:142094654-142094676 AGGTGTGGGAGCGGAGGAGCAGG - Intergenic
1050415991 9:5418514-5418536 GGGGGTGGCGGAGGAGGAGCAGG - Intronic
1051344479 9:16139940-16139962 CGGGGAGGAGGCGGAGGAACAGG - Intergenic
1058745510 9:107986681-107986703 CGGGGTGGGGGCGGAAGACCTGG + Intergenic
1059226175 9:112675120-112675142 GGGTGTGTCGGCAGAGGAGCAGG - Intergenic
1062576637 9:137211919-137211941 CGGTGTGGAACCAGAGGATCTGG + Intronic