ID: 1168154013

View in Genome Browser
Species Human (GRCh38)
Location 19:54463353-54463375
Sequence GCGAGGCGCAGCCGGAGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 334}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168154013_1168154029 12 Left 1168154013 19:54463353-54463375 CCCGGCCTCCGGCTGCGCCTCGC 0: 1
1: 0
2: 0
3: 27
4: 334
Right 1168154029 19:54463388-54463410 CCGGCGCCCCAGGGTGGGGCTGG 0: 1
1: 0
2: 8
3: 40
4: 486
1168154013_1168154030 15 Left 1168154013 19:54463353-54463375 CCCGGCCTCCGGCTGCGCCTCGC 0: 1
1: 0
2: 0
3: 27
4: 334
Right 1168154030 19:54463391-54463413 GCGCCCCAGGGTGGGGCTGGCGG 0: 1
1: 0
2: 11
3: 83
4: 722
1168154013_1168154027 8 Left 1168154013 19:54463353-54463375 CCCGGCCTCCGGCTGCGCCTCGC 0: 1
1: 0
2: 0
3: 27
4: 334
Right 1168154027 19:54463384-54463406 GGCGCCGGCGCCCCAGGGTGGGG 0: 1
1: 0
2: 1
3: 22
4: 239
1168154013_1168154035 22 Left 1168154013 19:54463353-54463375 CCCGGCCTCCGGCTGCGCCTCGC 0: 1
1: 0
2: 0
3: 27
4: 334
Right 1168154035 19:54463398-54463420 AGGGTGGGGCTGGCGGCAGCGGG 0: 1
1: 0
2: 7
3: 119
4: 779
1168154013_1168154025 6 Left 1168154013 19:54463353-54463375 CCCGGCCTCCGGCTGCGCCTCGC 0: 1
1: 0
2: 0
3: 27
4: 334
Right 1168154025 19:54463382-54463404 GCGGCGCCGGCGCCCCAGGGTGG 0: 1
1: 1
2: 1
3: 37
4: 325
1168154013_1168154024 3 Left 1168154013 19:54463353-54463375 CCCGGCCTCCGGCTGCGCCTCGC 0: 1
1: 0
2: 0
3: 27
4: 334
Right 1168154024 19:54463379-54463401 CAGGCGGCGCCGGCGCCCCAGGG 0: 1
1: 1
2: 1
3: 15
4: 186
1168154013_1168154026 7 Left 1168154013 19:54463353-54463375 CCCGGCCTCCGGCTGCGCCTCGC 0: 1
1: 0
2: 0
3: 27
4: 334
Right 1168154026 19:54463383-54463405 CGGCGCCGGCGCCCCAGGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 180
1168154013_1168154034 21 Left 1168154013 19:54463353-54463375 CCCGGCCTCCGGCTGCGCCTCGC 0: 1
1: 0
2: 0
3: 27
4: 334
Right 1168154034 19:54463397-54463419 CAGGGTGGGGCTGGCGGCAGCGG 0: 1
1: 0
2: 17
3: 182
4: 1197
1168154013_1168154020 -7 Left 1168154013 19:54463353-54463375 CCCGGCCTCCGGCTGCGCCTCGC 0: 1
1: 0
2: 0
3: 27
4: 334
Right 1168154020 19:54463369-54463391 GCCTCGCGGCCAGGCGGCGCCGG 0: 1
1: 0
2: 1
3: 15
4: 191
1168154013_1168154023 2 Left 1168154013 19:54463353-54463375 CCCGGCCTCCGGCTGCGCCTCGC 0: 1
1: 0
2: 0
3: 27
4: 334
Right 1168154023 19:54463378-54463400 CCAGGCGGCGCCGGCGCCCCAGG 0: 1
1: 0
2: 5
3: 40
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168154013 Original CRISPR GCGAGGCGCAGCCGGAGGCC GGG (reversed) Exonic
900344890 1:2205820-2205842 GCGAAGCGCAGGGGGAGGCTGGG + Intronic
900393508 1:2443860-2443882 GGGAGGCGCAGTCAGCGGCCGGG - Intronic
900513048 1:3069404-3069426 GCGCGGCCGAGCCGGGGGCCCGG - Intronic
900553086 1:3266286-3266308 GCCTGGCACAGCCGGACGCCAGG + Intronic
901021878 1:6260191-6260213 CCGGGGCGCAGCCAGAGCCCGGG - Intronic
901021912 1:6260292-6260314 GGGACGCGCAGCGCGAGGCCTGG + Intronic
901211213 1:7527051-7527073 GAGAGGAGCAGCCGCTGGCCTGG - Intronic
901540271 1:9910659-9910681 GCGAGGAGGAGGCGGTGGCCTGG + Intergenic
901659456 1:10789301-10789323 GGGAGGCTCAGCAGGAGGCCTGG - Intronic
902505951 1:16939163-16939185 TCTGGGCGCAGCCAGAGGCCTGG + Intronic
902823161 1:18955885-18955907 GCGAGCCGCCGCCGGGGGGCAGG + Exonic
905075770 1:35269121-35269143 GCGGGGCGCGGCCCGGGGCCGGG + Intronic
905734782 1:40317393-40317415 GCGGGGCGGAGCTGGATGCCTGG - Intronic
906522330 1:46474898-46474920 GCCAGGCACAGCAAGAGGCCTGG + Intergenic
907248687 1:53123620-53123642 GGGAGGCCCAGCCCGATGCCCGG - Intronic
908561326 1:65309557-65309579 GCGAGGCGAAGCCGCCGCCCTGG - Exonic
910935527 1:92483006-92483028 GCGGGGCGAAGGCGGAGCCCCGG - Exonic
911002518 1:93180642-93180664 GTGAGGCGCCGCCGAAGGCGCGG - Exonic
914032389 1:143972723-143972745 GGGAAGCGGAGCCGGGGGCCTGG + Intergenic
914157056 1:145095244-145095266 GGGAAGCGGAGCCGGGGGCCTGG - Exonic
914523023 1:148435001-148435023 GCGGAGCGCTGCGGGAGGCCCGG - Intergenic
915333259 1:155126464-155126486 GCGATGCGCAGCCGCAGGGAAGG + Intergenic
916470362 1:165117550-165117572 GCGAGGCGCACTCGGAGGCAGGG - Intergenic
916851855 1:168712258-168712280 CCTAGGGGCAGCTGGAGGCCTGG - Intronic
918332394 1:183472494-183472516 GCGAGGAGGAGCCGGAGGAGAGG + Exonic
919689628 1:200517464-200517486 GTGATGGGCAGCCGGAGGGCTGG + Intergenic
919797877 1:201332219-201332241 GCGAGGGGATGCAGGAGGCCAGG - Exonic
919878751 1:201888895-201888917 GCGGGGCCCAGCCCGCGGCCAGG - Exonic
920467867 1:206203607-206203629 GGGAAGCGGAGCCGGGGGCCTGG + Intronic
920805613 1:209231563-209231585 GAGAGGCGCAGGCAGGGGCCGGG - Intergenic
922783830 1:228273311-228273333 GGGAGGTGCAGGCGGAGGCGGGG + Exonic
922802983 1:228372479-228372501 CGGAGGAGCAGCAGGAGGCCAGG + Exonic
923490255 1:234478324-234478346 GCGAGGCGGGCCCGGACGCCCGG - Exonic
924536421 1:244939688-244939710 GGGAGGCTCAGGCAGAGGCCAGG - Intergenic
1066221198 10:33336804-33336826 GCCCGGCGCAGCCGGGGGCTGGG - Intergenic
1067830972 10:49610805-49610827 GCGCGGCGCTGCAGGAGCCCCGG + Exonic
1069158092 10:65054054-65054076 GCGGGTAGCAGCCGGCGGCCAGG - Intergenic
1070866702 10:79711535-79711557 GTGAGGCCCAACGGGAGGCCCGG + Intronic
1070880491 10:79849656-79849678 GTGAGGCCCAACGGGAGGCCCGG + Intronic
1071467585 10:85955595-85955617 CCCAGGCACAGCTGGAGGCCTGG - Intronic
1071517815 10:86310612-86310634 GCGTGGCGCAGTGGGAAGCCTGG - Intronic
1071618172 10:87094969-87094991 CCGCGGCGGAGGCGGAGGCCCGG - Intronic
1071633612 10:87233758-87233780 GTGAGGCCCAACGGGAGGCCCGG + Intronic
1071647060 10:87365974-87365996 GTGAGGCCCAACGGGAGGCCCGG + Intronic
1073257438 10:102162110-102162132 GCGAGGTGCAGCCGGAGACTGGG + Exonic
1074861273 10:117512201-117512223 GGGCGTCGCAGCAGGAGGCCAGG - Intergenic
1075191676 10:120315349-120315371 GTGAGGCCCATCTGGAGGCCTGG - Intergenic
1075264274 10:120987559-120987581 GGGAGGCGGAGCTGGTGGCCAGG + Intergenic
1075574482 10:123568929-123568951 GAGAGGCTCTGCTGGAGGCCAGG + Intergenic
1075705426 10:124497503-124497525 GGGAGCCCCACCCGGAGGCCTGG - Intronic
1076220773 10:128731601-128731623 GCCAGGCGCTGCCTGAGGTCTGG + Intergenic
1076373954 10:129971504-129971526 GGGCTGCGCACCCGGAGGCCGGG + Intergenic
1076488038 10:130836744-130836766 GAGAGGCGCAGGCACAGGCCAGG - Intergenic
1076515715 10:131043401-131043423 GCAAGGAGCAGCCGGCTGCCTGG - Intergenic
1076614028 10:131744565-131744587 GCCAAGCTCAGGCGGAGGCCTGG + Intergenic
1077060483 11:615767-615789 GGGAGGCGGAGGCGGAGGCGGGG - Intronic
1077094747 11:794547-794569 GCTGGGGCCAGCCGGAGGCCAGG + Intronic
1077472103 11:2768941-2768963 GCGAGGGGCAGGCTGAGGGCAGG - Intronic
1079237040 11:18698643-18698665 CCGAGCAGCAGCCGGGGGCCTGG + Intronic
1081871012 11:46382467-46382489 GCGGGGCGCAGTCAGAGGGCAGG + Intronic
1083365484 11:62139353-62139375 GGGAGGCAAAGCAGGAGGCCAGG - Intronic
1083610311 11:64001119-64001141 CCGGGGCGCAGCGGGAGGCATGG + Intronic
1083883009 11:65557794-65557816 GCGGGGCGCAGGCGGGGGCGGGG - Exonic
1083997117 11:66278159-66278181 GCGGGGCGGAGCCGGGGGCGGGG - Intergenic
1084066158 11:66705504-66705526 GCAGGGAGCAGCCGGAGGGCTGG - Intronic
1084377163 11:68785267-68785289 GCCAGGCGCAGTGGGAGGCTGGG + Intronic
1084385931 11:68842662-68842684 GAGAGGAGTAGCTGGAGGCCAGG + Intronic
1084494128 11:69494349-69494371 ACGAGGGGCAGCCCGAGGGCAGG + Intergenic
1084575455 11:69985707-69985729 GCCCCGCGCAGCGGGAGGCCGGG + Intergenic
1091301297 11:134509817-134509839 GAGAGGCGTAGCTGGAGCCCTGG - Intergenic
1091581592 12:1793729-1793751 CCGAGGCGCCGCCGCAGTCCTGG + Exonic
1091718433 12:2795594-2795616 CCGAGCCGCAGCCCGGGGCCAGG + Intronic
1091866205 12:3839232-3839254 GCGTCGAGCAGCCGGCGGCCTGG + Intronic
1095954165 12:47797031-47797053 GCGGGCCGCCGCCGGAGGCTGGG + Exonic
1096647719 12:53047540-53047562 GCTGGGAGCAGCGGGAGGCCGGG + Intronic
1097250920 12:57632020-57632042 GCAAGAGGTAGCCGGAGGCCGGG + Exonic
1100444603 12:94649866-94649888 GCGGTGCGCAGCCGGAGCGCGGG - Intronic
1102349885 12:112184474-112184496 GCGAGCTGCAGATGGAGGCCTGG + Exonic
1102514932 12:113440018-113440040 ACGAGGTGCTGCCTGAGGCCTGG - Intergenic
1102644623 12:114396139-114396161 GCGAGCCGCGGCCGGGGGCGGGG + Intronic
1102763150 12:115407250-115407272 GCACGGCTCAGTCGGAGGCCGGG + Intergenic
1103521080 12:121537405-121537427 CCGAGGCCCAGGCGGAAGCCGGG - Intronic
1103897984 12:124286504-124286526 ACCAGGCCCAGCCGGAGGGCAGG - Intronic
1104568276 12:129903875-129903897 CCGAGGCGCAGCGGCCGGCCTGG - Intergenic
1104891711 12:132143471-132143493 GCGCGGCGCGGCGGGAGGACAGG + Intronic
1105503043 13:20988928-20988950 GCAAGACGCCGCCGGAGACCGGG - Exonic
1106304023 13:28494757-28494779 GTGAGGCGCGGCTGGGGGCCGGG - Intronic
1110347472 13:74465169-74465191 GCGATGAGCAGCTGGAGCCCAGG - Intergenic
1116647079 14:47541829-47541851 GGGAGGAGCAGCCAGAGCCCTGG - Intronic
1118292966 14:64542243-64542265 GCGAGGCGCAGGGGGAATCCCGG - Exonic
1119330058 14:73787017-73787039 GCGCGGCCCAGCCCGAGCCCCGG + Intronic
1121342774 14:93115328-93115350 GCGGGGCGCGGCGGGCGGCCGGG + Intronic
1121670923 14:95710228-95710250 CCGGGACGCAGCAGGAGGCCAGG - Exonic
1121866527 14:97367402-97367424 GCCAGCCGCAGCCCCAGGCCTGG - Intergenic
1122077699 14:99246451-99246473 GCCAGGCGCGCCCGCAGGCCTGG + Intronic
1122601244 14:102922977-102922999 GGCAGGAGCCGCCGGAGGCCGGG - Intronic
1122697406 14:103562753-103562775 GCGTGGCGCTGCCGGCGGCTAGG - Intronic
1123711563 15:22991516-22991538 GGGAGGCGCTGGCGGAGGCTTGG + Intronic
1124250991 15:28106569-28106591 GCCAGGCGGGGCCGGAGGCCGGG - Intergenic
1124427047 15:29570949-29570971 GCGCGGCGCGGCCGGCGGGCGGG - Intergenic
1124629254 15:31327580-31327602 GCGAGCCGGAGCCCGAGGCGGGG + Exonic
1125601200 15:40916597-40916619 GGGAGGTGCAGAGGGAGGCCTGG + Intergenic
1126171971 15:45702466-45702488 GCCAGGTGGAGGCGGAGGCCTGG - Intergenic
1128743357 15:70097677-70097699 GGGAGACGCAGCCCGAGACCGGG + Exonic
1130047120 15:80453997-80454019 GCTAGGCCCGGCGGGAGGCCTGG - Intronic
1131455587 15:92580193-92580215 GCCAGGGGCTGCCAGAGGCCCGG + Intergenic
1132399828 15:101498450-101498472 GAGAGGCACGGCCAGAGGCCAGG + Intronic
1132426854 15:101724657-101724679 GCGGGGCGGGGCCTGAGGCCAGG + Intergenic
1132646782 16:1002922-1002944 GCGACGCGATGCCGGTGGCCTGG - Intergenic
1132719759 16:1309845-1309867 GCGCGGGGCAGTCGGGGGCCCGG - Intronic
1133218507 16:4307802-4307824 GCGGGGCGCCGCCGGTGACCCGG - Intergenic
1134527785 16:14957744-14957766 GCAGGGGGCAGCTGGAGGCCCGG - Intergenic
1136141656 16:28292594-28292616 TGGAGCCGCAGCCGGAGCCCGGG + Exonic
1136356138 16:29745762-29745784 CAGAGGCGCCTCCGGAGGCCTGG - Intronic
1136485583 16:30570010-30570032 GGGCGGCGGGGCCGGAGGCCTGG - Exonic
1136784275 16:32925502-32925524 GCAAGGAGCAGCGGGAGCCCGGG + Intergenic
1136885509 16:33928304-33928326 GCAAGGAGCAGCGGGAGCCCGGG - Intergenic
1138179162 16:54930735-54930757 GCGAGGCGCGCCTGGCGGCCGGG + Intergenic
1141841960 16:86579220-86579242 CGGAGGCGCAGCCGGAGGCGGGG + Exonic
1142147844 16:88499927-88499949 GAGGAGCGCAGCCGGAGCCCTGG + Intronic
1142240987 16:88944964-88944986 GCGTGGTCCAGCGGGAGGCCAGG + Intronic
1142321451 16:89385810-89385832 CCGCTGCGCAGCCAGAGGCCGGG + Intronic
1142336264 16:89491061-89491083 GGGCAGCGCGGCCGGAGGCCGGG - Intronic
1142358106 16:89613612-89613634 GGGAGGGGCAGCAGGTGGCCGGG + Intronic
1144606155 17:16667092-16667114 GCGGGTAGCAGCCGGCGGCCAGG + Intergenic
1145236702 17:21213824-21213846 GCGGGGCGGGGCCCGAGGCCGGG - Intronic
1145243592 17:21253282-21253304 GCGCGGCGCCGGCGGGGGCCGGG + Exonic
1148178205 17:45585310-45585332 GCGAGGCGCGGCTGGACTCCGGG + Intergenic
1148775898 17:50095602-50095624 GGGAGGGGCAGCCGGGGGCTAGG + Intronic
1148930148 17:51120937-51120959 GCGGGGCGCCGCGGGAGGCCAGG + Intergenic
1148930157 17:51120954-51120976 GCCAGGCGCGGCCGGGGGCGGGG + Intergenic
1149626519 17:58083918-58083940 TCGTGGCGCTGCTGGAGGCCCGG + Intronic
1150647502 17:66988507-66988529 GGGAGGCCCTGCAGGAGGCCAGG - Intronic
1151801982 17:76384277-76384299 GCGCAGCGCAGACGGAGGCGCGG - Intronic
1152392343 17:80010318-80010340 GGGAGCCGCGGCCCGAGGCCGGG - Exonic
1152676707 17:81645062-81645084 GGGAGGACCAGGCGGAGGCCTGG + Exonic
1152706414 17:81845956-81845978 GCCAGGAGCTGCCGGAGGACTGG - Exonic
1152746051 17:82039842-82039864 GCCAGGCACAGCAGGAGGCAAGG + Intergenic
1152758880 17:82098192-82098214 GCGCGGCGGAGAGGGAGGCCGGG + Exonic
1152865073 17:82717373-82717395 GTGAGGCGCAGCAGCTGGCCTGG - Intronic
1153900677 18:9614671-9614693 GCGGGGCGCGGCCGGGGGCCCGG - Intronic
1154241513 18:12657786-12657808 GCGAGGGGCCGCGGGAGCCCGGG - Exonic
1157506661 18:48231198-48231220 GCCAGGGACAGCCTGAGGCCTGG + Intronic
1160348607 18:78154735-78154757 GCGGGGCACAGCCGGAGTCAGGG - Intergenic
1160486709 18:79299924-79299946 ACGAGGAGCAGCCGTAGGCCGGG + Intronic
1160505513 18:79424151-79424173 GCCAGGCCCAGCCAGAGGTCGGG + Intronic
1160544401 18:79643207-79643229 CAGAGGCACAGGCGGAGGCCAGG + Intergenic
1160567758 18:79797904-79797926 GCGGGGCGGCGCCGGAGTCCGGG + Intergenic
1161179084 19:2867443-2867465 CCGAGCCGGAGCCGGAGCCCTGG + Intronic
1161215659 19:3094157-3094179 GGGACGCGCAGCCGGGAGCCGGG - Intergenic
1161264834 19:3359453-3359475 GCGCGGAGCAGCCTGAGGCGCGG + Intergenic
1161400866 19:4065837-4065859 GGGCCGCGCAGCCGGAAGCCGGG + Intronic
1161424984 19:4198396-4198418 GCGGGGAGCGGCCGGAGGGCGGG - Intronic
1161567996 19:5013966-5013988 AAGAGGCGCAGCCCGTGGCCCGG + Intronic
1161585879 19:5105165-5105187 GCGGGGCAGAGCAGGAGGCCAGG + Intronic
1161743414 19:6039884-6039906 GTAAGAGGCAGCCGGAGGCCCGG - Intronic
1162109106 19:8390637-8390659 GCTATACGGAGCCGGAGGCCCGG + Intronic
1162410442 19:10502448-10502470 GCGCTGCGCAGAAGGAGGCCCGG - Intronic
1162461739 19:10817697-10817719 GGGAGGCGGAGCAGGAGGCAGGG + Intronic
1163102595 19:15107376-15107398 GGGCGGCGCGGCCGGAGCCCGGG + Intergenic
1163662993 19:18589554-18589576 GCGAGGCGGCGGCGAAGGCCTGG - Exonic
1164739832 19:30567645-30567667 GGGAGGGGCAGCTGGAGCCCTGG - Intronic
1165433565 19:35785128-35785150 GCGAGGGGCAGGTGGAGGCCTGG + Intronic
1166551494 19:43668809-43668831 TCGAGGCGGAGCCAGAGGGCGGG - Intronic
1166834534 19:45659244-45659266 GCGGGGAGCAGGCGGGGGCCTGG - Intergenic
1167040310 19:47019871-47019893 GCGGGGCGCAGCGGGACGCGCGG - Exonic
1167278389 19:48552414-48552436 GCCACCCGCAGCCGCAGGCCTGG + Intronic
1167504170 19:49862591-49862613 TCCAGACGCAGCCGGACGCCCGG - Exonic
1167557066 19:50203355-50203377 GCGAGGCGCGGGGGGCGGCCGGG - Intronic
1167620408 19:50557041-50557063 GAGCGGCGCGGCTGGAGGCCAGG + Intronic
1167638488 19:50668106-50668128 GAGTGGCGCAGCCGCGGGCCCGG + Exonic
1167792230 19:51689639-51689661 GGGAGGAGCACCCGGGGGCCTGG + Intergenic
1168078122 19:53991617-53991639 GCCGGGCGCGGGCGGAGGCCAGG + Intergenic
1168078176 19:53991769-53991791 GCCAGGCTCAGCCCCAGGCCAGG - Intergenic
1168107090 19:54172192-54172214 GGGAGGAGGAGCCGGGGGCCTGG - Intronic
1168107104 19:54172229-54172251 GGGAGGAGGAGCCGGGGGCCTGG - Intronic
1168107118 19:54172266-54172288 GGGAGGAGGAGCCGGGGGCCTGG - Intronic
1168107132 19:54172303-54172325 GGGAGGAGGAGCCGGGGGCCTGG - Intronic
1168107146 19:54172340-54172362 GGGAGGAGGAGCCGGGGGCCTGG - Intronic
1168107160 19:54172377-54172399 GGGAGGAGGAGCCGGGGGCCTGG - Intronic
1168107187 19:54172451-54172473 GGGAGGAGGAGCCGGGGGCCTGG - Intronic
1168107216 19:54172525-54172547 GGGAGGAGGAGCCGGGGGCCTGG - Intronic
1168154013 19:54463353-54463375 GCGAGGCGCAGCCGGAGGCCGGG - Exonic
1168283849 19:55320835-55320857 GGGAGGAGGAGCTGGAGGCCTGG - Intronic
1168327735 19:55546704-55546726 GGGAGGAGGAGCTGGAGGCCTGG - Intergenic
1168459084 19:56538854-56538876 GCGGGGCGCGGCCGGGGGCGGGG + Intergenic
925128351 2:1477334-1477356 GGTAGGCGCGGCCGGAGTCCCGG - Exonic
926075521 2:9939751-9939773 GCGCCTCGCAGCAGGAGGCCAGG + Intergenic
927714272 2:25342082-25342104 GCGAGCGGCGGGCGGAGGCCTGG - Intronic
929775633 2:44929247-44929269 GAGAGGGGCAGGCGAAGGCCGGG - Intergenic
929921371 2:46174169-46174191 GTGAGGCCCAGCCTGAGGCTTGG + Intronic
930011400 2:46940980-46941002 GCGAGGCGCCCCCGGGCGCCGGG + Intronic
930700873 2:54456851-54456873 GGGAGGCGCCGGCGGAGGCAGGG - Intronic
935301535 2:101697654-101697676 GGGAGGCGGAGGCGGAGGCGGGG - Intronic
935353661 2:102177985-102178007 GCGAGGGGAAGCTGGAGGACAGG - Exonic
935645363 2:105329747-105329769 GCCAGGCGCTGGCGGAGGGCGGG + Exonic
937506223 2:122540305-122540327 GGGAGGCACAGTGGGAGGCCAGG + Intergenic
938101086 2:128498661-128498683 GGGAGGAGCAGCCTGAGGCTTGG + Intergenic
938255875 2:129859270-129859292 GAAAGGCACAGCCTGAGGCCCGG + Intergenic
942151037 2:173076088-173076110 CCGAGGCTCCGCCGGAGCCCGGG + Intronic
946311195 2:218883524-218883546 GCGGGGCGGGGCGGGAGGCCTGG - Intronic
946370639 2:219279480-219279502 GCGGGGCGCCGCAGGAGGCCGGG + Exonic
946395471 2:219441977-219441999 GCGGGGCGGAGTCGGAGGCGGGG - Intronic
947633273 2:231666935-231666957 GGGAGGCGCACCCTGAGGCTAGG - Intergenic
947748643 2:232522040-232522062 GCGCGGCGCCGCCCGGGGCCTGG + Exonic
948574505 2:238941049-238941071 GTGAGGCGAGGCTGGAGGCCTGG - Intergenic
948738229 2:240025125-240025147 GGGAGCCGCCGCCAGAGGCCGGG + Intronic
1170566576 20:17611287-17611309 GCAGGGCCCAGCCGGTGGCCTGG + Intergenic
1172607036 20:36220940-36220962 TAGAGGCGCAGGCAGAGGCCAGG - Intronic
1175141153 20:56861019-56861041 GGGAGGGGCAGCTGGAGTCCCGG + Intergenic
1175399482 20:58692601-58692623 GGGCGGCGCCGCTGGAGGCCGGG + Exonic
1175527641 20:59646587-59646609 GGGAGGCACAGCCAGAGCCCAGG + Intronic
1175894683 20:62330843-62330865 GCGTGGGTCAGCGGGAGGCCGGG + Exonic
1176131740 20:63499236-63499258 GCGAGGCGATGCGGGAGGCGCGG + Exonic
1176385332 21:6136152-6136174 GCGGGGCTCAGCGGGTGGCCAGG + Intergenic
1178417109 21:32412818-32412840 GCGGGGCGGAGGCGCAGGCCCGG - Exonic
1178544297 21:33480084-33480106 GCTGGGCGCAGCGGGACGCCGGG + Intergenic
1178570233 21:33728987-33729009 GAGATGAGCAGCCTGAGGCCAGG + Intronic
1179738141 21:43402100-43402122 GCGGGGCTCAGCGGGTGGCCAGG - Intergenic
1179996026 21:44974835-44974857 GAGAGGCGGAGAGGGAGGCCAGG - Intronic
1180161548 21:46000609-46000631 GGGAGGCGGGGCAGGAGGCCGGG + Intronic
1180161797 21:46001542-46001564 GCCAGGTGGAGCTGGAGGCCTGG - Intronic
1180188779 21:46153049-46153071 GCGAGGCCGGGCAGGAGGCCAGG + Intronic
1180650352 22:17370753-17370775 GCGCGGCGCACTCGGCGGCCAGG + Intronic
1180875071 22:19171379-19171401 GGGAGGCGCCGCCAGAGGCTCGG + Intergenic
1180961929 22:19766159-19766181 GCGGGGCGCAGCCGTCGGGCCGG - Intronic
1181169848 22:21001949-21001971 GCGAGGCTCCTCCGGATGCCCGG - Exonic
1181422218 22:22810171-22810193 GCCAGGAGCAGCCAGAGGCTGGG + Intronic
1181787620 22:25238361-25238383 TCCAGGCGCAGCCCCAGGCCAGG + Intergenic
1182123248 22:27800114-27800136 CGGCGGCGCAGCCGGAGGCCTGG - Exonic
1182718180 22:32376688-32376710 GAGAGGAGCAGCAGGAGGACAGG - Intronic
1183162480 22:36124116-36124138 GCGCTGCGCAGCCGCAGCCCGGG - Intergenic
1183386805 22:37519550-37519572 GGGAGGCGCAGCCGGACGGCCGG - Intergenic
1183411766 22:37659084-37659106 GCCCGGCGCGTCCGGAGGCCCGG - Exonic
1183425051 22:37734796-37734818 GCTGGGGGCAGCCAGAGGCCTGG + Exonic
1183653226 22:39170981-39171003 GCGCTGGGCAGCCGGACGCCGGG - Intergenic
1184035127 22:41914600-41914622 GCGAGCGCGAGCCGGAGGCCGGG + Exonic
1184099845 22:42336315-42336337 CCGAGGCCCAGCCTGAGGCCTGG - Intronic
1184540813 22:45123043-45123065 GTGAGGGGCAGCTTGAGGCCTGG - Intergenic
1184681131 22:46072547-46072569 GCGCGGCGCCGGCGGCGGCCAGG + Intronic
1185255182 22:49827720-49827742 TCGGGGCCCAGCTGGAGGCCCGG + Intergenic
1185330739 22:50251107-50251129 GCCGGGAGCAGCCGGAGGCCTGG + Exonic
1185335935 22:50270874-50270896 GCGAGCCGGGGCAGGAGGCCTGG - Intergenic
949987767 3:9553534-9553556 GCGAGGAGCAGGCGGTGGGCAGG + Intronic
950208319 3:11096904-11096926 GAGAGGCTCAGCTGGAGGCAGGG - Intergenic
950433980 3:12967685-12967707 GCTTGGCGCAGCGCGAGGCCGGG + Intronic
950710543 3:14810515-14810537 CAGAGGCGCAGGCGGAGGCACGG + Intergenic
952274263 3:31861884-31861906 GAGAGGGGCAGCTGGAAGCCTGG + Intronic
952338129 3:32422366-32422388 GCCAGTCCCAGCAGGAGGCCTGG - Intronic
952451760 3:33440054-33440076 GGGTGGCGCTGCCGGCGGCCCGG - Exonic
952650949 3:35725905-35725927 GCAAGGCACAGACGGGGGCCAGG - Intronic
952867161 3:37861918-37861940 GGGAGGCGGAGCGGGAGGCCCGG - Intergenic
953289758 3:41649506-41649528 GCCAGGAGCAGGGGGAGGCCAGG - Intronic
953623959 3:44555284-44555306 GGGAGGCGCGGCCGGAGCTCGGG + Exonic
953909209 3:46883302-46883324 GGGAGGGAGAGCCGGAGGCCGGG - Intronic
954194837 3:48990345-48990367 GCCAGGCTCAGGCGGCGGCCGGG + Exonic
954198041 3:49007820-49007842 CGGAGGCGGAGGCGGAGGCCCGG + Intronic
954278032 3:49554857-49554879 GTGAGCTGCAGCCTGAGGCCGGG + Intronic
954333343 3:49902414-49902436 TCGAGGCCTCGCCGGAGGCCTGG + Exonic
954796122 3:53161982-53162004 GCGAGGCCCGGCGGGCGGCCTGG - Intronic
954839110 3:53495473-53495495 GCGCGGTGCAGCCGGAGGGGCGG + Intronic
955487351 3:59448237-59448259 GTGAGGCTCAGCCAGGGGCCTGG - Intergenic
956752234 3:72352523-72352545 GCAAGGGGCAGCGGGAGGCCAGG - Intergenic
957919895 3:86733437-86733459 GAGAGGCGCAGGCGGGAGCCGGG - Intergenic
961404148 3:126666992-126667014 GGGAGGCGCAGCCAGCGGCAGGG + Intergenic
961827502 3:129606680-129606702 GCGAGGCGCGGCCGGGAGCCGGG + Exonic
965139224 3:164814253-164814275 GAGAGGCGCAGGCGGGAGCCGGG + Intergenic
966668524 3:182500321-182500343 GAGAGGCGCAGGAGGAGACCTGG - Intergenic
966775152 3:183537143-183537165 CAGAGGAGCAGCAGGAGGCCTGG - Intronic
968504900 4:967188-967210 GCGAGGCCACGCCAGAGGCCTGG - Exonic
968515154 4:1012592-1012614 GGGCGGCGCTGGCGGAGGCCAGG - Intronic
968593736 4:1472213-1472235 CCGCGGGGCAGCCGGAGCCCGGG + Intergenic
968607727 4:1543384-1543406 GGGAGGGGCAGCTGGAGACCTGG + Intergenic
968703696 4:2068755-2068777 GGGAGGCTCAGCCCGGGGCCTGG - Exonic
969479678 4:7441286-7441308 GTGAGGGGCAGCCTGAGGCCAGG + Intronic
969737348 4:9000616-9000638 GCGAGGCGCAGGCCCCGGCCCGG + Intergenic
973981936 4:56314725-56314747 GCCAGGCGCACCTGGAGGACTGG + Exonic
975131839 4:70839378-70839400 GCGAGGCGCACACGGAGGGACGG + Intronic
976226364 4:82798168-82798190 GCGGCGCGCAGCGGGAGGCGAGG + Intronic
976595583 4:86892255-86892277 GCGAGCCGGCGCCGGCGGCCTGG + Intronic
977410269 4:96653478-96653500 GCCAGGGACAGCCGGAGGCATGG + Intergenic
981475075 4:145180024-145180046 GCGTCGAGCAGCCGGCGGCCTGG - Intronic
981531728 4:145760848-145760870 GGGAGGCGCAGTCTGAGGTCGGG + Exonic
985423577 4:189807246-189807268 GAGAGGCGCAGGCCGAGCCCGGG - Intergenic
985692131 5:1319360-1319382 GGGGGGGGCAGCCGGCGGCCAGG + Intronic
987090565 5:14505269-14505291 GCAGGGAGCGGCCGGAGGCCAGG + Intronic
992796079 5:80256098-80256120 GCGAGGCGGGGCCGGCGGCGGGG - Intergenic
995069276 5:107899412-107899434 GAGAGGGACAGCCTGAGGCCAGG + Intronic
998307638 5:141095401-141095423 GCGAGGAGCAGCCTGAGATCAGG + Exonic
1003290839 6:4776822-4776844 GCGGGGGGCGGCCCGAGGCCGGG - Intronic
1003627745 6:7758716-7758738 GCGAGGCACAGCCGGACCCAAGG - Intronic
1004080321 6:12386195-12386217 GCGAGCTGCAGCCCCAGGCCTGG + Intergenic
1004709276 6:18155128-18155150 GCGGGGCGCGGGCGGAGGCGGGG - Intergenic
1004709283 6:18155145-18155167 GCGGGGCGCGGGCGGAGGCGGGG - Intergenic
1004709290 6:18155162-18155184 GCGGGGCGCGGGCGGAGGCGGGG - Intergenic
1005775768 6:29129718-29129740 GCCAGGAGCAGGCAGAGGCCAGG - Intergenic
1006406721 6:33849840-33849862 GCGGTGGGCAGCAGGAGGCCTGG - Intergenic
1006945885 6:37784245-37784267 CCGAGGCTCTGCCGTAGGCCAGG + Intergenic
1007383578 6:41505412-41505434 GGGAGGGGCAGGCGGAGGCTCGG + Intergenic
1009413391 6:63392264-63392286 GCCAGGAGCAGCCCTAGGCCAGG - Intergenic
1015251875 6:131135668-131135690 GCGAGGCCGAGGCGGAGGCCAGG - Exonic
1016923217 6:149317067-149317089 GCGCGGCGCCGCCGGCCGCCCGG + Intronic
1016982086 6:149863417-149863439 GCGAGGCGCGCGCGGTGGCCAGG + Exonic
1017103308 6:150866429-150866451 GCGAGGAGCAGGAGGAGGGCGGG + Intronic
1017237294 6:152130011-152130033 GTGAGGGGCTGCTGGAGGCCAGG + Intronic
1018612660 6:165660773-165660795 GCGAGGCGCAGACAAAGGCTCGG + Intronic
1018895830 6:168016437-168016459 GGGAGGAGCAGCCGGTGGCTGGG - Intronic
1019404697 7:877318-877340 ACGAGGGGCAGGGGGAGGCCAGG - Intronic
1019514187 7:1432602-1432624 GAGAGGGGCAGCCGGGAGCCTGG - Intronic
1019559385 7:1648425-1648447 GCCAGGCCCTGCCGGAGTCCTGG + Intergenic
1019765061 7:2844051-2844073 GCGACGCGGAGCGCGAGGCCCGG - Exonic
1019769781 7:2876448-2876470 GCGGGGCGCTGCCTGAGGCCCGG + Intergenic
1021490418 7:21214299-21214321 GCGAGGAGCAGCTGGTGGCATGG + Intergenic
1022094573 7:27130625-27130647 GGGCGGCGCAGACGGCGGCCCGG - Exonic
1025283786 7:57647091-57647113 GCGATGCGCGGCCGGGGGTCTGG + Intergenic
1026359757 7:69592028-69592050 GCCAGGTACAGCAGGAGGCCTGG + Intergenic
1027774148 7:82443817-82443839 CCGAGGCGAAGGCGGAGGCGGGG + Intergenic
1028762352 7:94509952-94509974 GGGAGGCGCAGGTGGCGGCCTGG + Exonic
1029549996 7:101232572-101232594 GTGAGGCGCAGGCTGGGGCCGGG - Intronic
1031895926 7:127347825-127347847 GCGAGGTCCCGCCGGCGGCCAGG + Intronic
1032706409 7:134424057-134424079 GTGAGGCTCAGCTGGAGGCTTGG + Intergenic
1033050655 7:138001526-138001548 GCGAGGAGCAGCTGGAGTCCTGG - Intronic
1034137378 7:148783272-148783294 GCGTGGCGATGCCGGGGGCCAGG - Intronic
1034959794 7:155358140-155358162 CCGAGGCCCAGCTGGAGGCAGGG + Exonic
1036124475 8:6050215-6050237 GCCAAGCGAAGCGGGAGGCCCGG + Intergenic
1036632313 8:10524436-10524458 ACGAGGCTCAGCCTGTGGCCAGG + Intergenic
1042271524 8:66961418-66961440 CCGAGGCGCCGGCGGACGCCGGG - Exonic
1044666690 8:94640278-94640300 GCGCGGCAGAGCCGGACGCCAGG - Intergenic
1045111108 8:98940272-98940294 GCGAGGGGCTGACGGTGGCCTGG + Intronic
1048112824 8:131487047-131487069 GCGAGGCGCGGGCGGAAACCAGG + Intergenic
1048554127 8:135458053-135458075 ACGCGGCGGAGACGGAGGCCCGG + Intronic
1049214180 8:141400203-141400225 GCCAGGCGCAGAGGCAGGCCAGG - Intronic
1049277338 8:141726380-141726402 GAGAGGAGCAGCCGGAGCCCAGG - Intergenic
1049411453 8:142475651-142475673 GCGGGGCGGAGCCGGAGCCCTGG + Intronic
1049426300 8:142539471-142539493 GGGAGGCACAGGCGGAGGCGTGG - Intronic
1049615639 8:143574729-143574751 GGGAGGCGCAGCCCGTGGGCTGG + Intergenic
1049643926 8:143727754-143727776 CCGAGGCGGAGCCGGAGCGCAGG - Exonic
1049654247 8:143790804-143790826 GTGAGGCGCAGCGGGAGACGTGG + Intergenic
1049746932 8:144266967-144266989 GCGAGATGTAGCTGGAGGCCAGG - Exonic
1049762778 8:144338433-144338455 CCAAGGCACAGCCGGAGGCGTGG + Intergenic
1049777562 8:144413647-144413669 GGGAGGCGGAGCCGCAGGCCTGG + Intronic
1053071133 9:35102728-35102750 TCGTGCCGCAGCAGGAGGCCTGG - Exonic
1055461491 9:76524048-76524070 GAGAGGCGCAGCCGGGAACCGGG - Intergenic
1056721041 9:89072273-89072295 GGGAGGCCCACCCCGAGGCCAGG + Intronic
1057208204 9:93185405-93185427 CCGAGGCGAAGCCTGAGCCCGGG + Exonic
1057230335 9:93317823-93317845 GTGATCCGCAGCCGGGGGCCAGG - Intronic
1057432165 9:95004739-95004761 GCGCGGGGCGGCCGGAGCCCGGG + Intronic
1057432189 9:95004791-95004813 GCGCGGGGCGGCCGGAGCCCGGG + Intronic
1059390941 9:113999225-113999247 GCGAGGGGCAGGCGGGGCCCTGG + Intronic
1059390987 9:113999365-113999387 GCGAGGCGCAGGCGGGGCCCTGG + Intronic
1060855863 9:126914840-126914862 GCCAGGCGCAGCTGGAGCGCGGG - Exonic
1061288665 9:129638677-129638699 GCAAGGAGGAGCAGGAGGCCAGG + Intronic
1061991788 9:134163341-134163363 GCGGGGCGAGGCCGGAGGCCGGG - Intergenic
1062276697 9:135734787-135734809 GCGAGCCGCATCCGCAGCCCAGG + Intronic
1062367731 9:136219316-136219338 TGGAAGCGCAGCCGGAGCCCAGG - Intronic
1185779040 X:2829528-2829550 GAGAGGCGCAGGGGTAGGCCGGG + Intronic
1186465109 X:9779036-9779058 GCGGGGCGCACCTGGAGGCTTGG - Intronic
1187464409 X:19515024-19515046 GGGCGGCGCGGCCGGCGGCCCGG - Exonic
1187648318 X:21374110-21374132 GCGAGGCAGAGCCAGAGCCCGGG - Intergenic
1190542909 X:51496632-51496654 GCGGGGCGCAGGCGGAGGCGGGG + Intergenic
1191898601 X:66018870-66018892 GCGTGGCACTGCAGGAGGCCAGG - Intergenic
1196400580 X:115312017-115312039 GCGAGGGGCTGCCGGAGCACAGG - Intergenic