ID: 1168154109

View in Genome Browser
Species Human (GRCh38)
Location 19:54463687-54463709
Sequence GCTCTCCACCAAGGAGGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168154109_1168154113 -5 Left 1168154109 19:54463687-54463709 CCAGTCCCTCCTTGGTGGAGAGC 0: 1
1: 0
2: 2
3: 19
4: 200
Right 1168154113 19:54463705-54463727 AGAGCCTGACACCGCTGCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 205
1168154109_1168154116 5 Left 1168154109 19:54463687-54463709 CCAGTCCCTCCTTGGTGGAGAGC 0: 1
1: 0
2: 2
3: 19
4: 200
Right 1168154116 19:54463715-54463737 ACCGCTGCTCTGGGACTTCCCGG 0: 1
1: 0
2: 2
3: 17
4: 160
1168154109_1168154114 -4 Left 1168154109 19:54463687-54463709 CCAGTCCCTCCTTGGTGGAGAGC 0: 1
1: 0
2: 2
3: 19
4: 200
Right 1168154114 19:54463706-54463728 GAGCCTGACACCGCTGCTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 108
1168154109_1168154120 28 Left 1168154109 19:54463687-54463709 CCAGTCCCTCCTTGGTGGAGAGC 0: 1
1: 0
2: 2
3: 19
4: 200
Right 1168154120 19:54463738-54463760 CTGCGCCCTCCCCCAGCGCCAGG 0: 1
1: 0
2: 5
3: 65
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168154109 Original CRISPR GCTCTCCACCAAGGAGGGAC TGG (reversed) Exonic
900226995 1:1537541-1537563 GCCCTCCAGGAAGGAGGGCCAGG - Intronic
900252140 1:1676390-1676412 GCTCGCCTCCCAGCAGGGACAGG + Exonic
900262550 1:1739248-1739270 GCTCGCCTCCCAGCAGGGACAGG + Exonic
900385023 1:2406601-2406623 TCTCTCCTCCAAGGAGGCCCTGG + Exonic
902695775 1:18139884-18139906 GCTCTCAACCAAGGACAGACAGG + Intronic
902765687 1:18613297-18613319 GCTCTCTACCAAAGAGGAAATGG + Intergenic
902804715 1:18853930-18853952 GCTCTCAACCTTGGAGAGACTGG + Intronic
903194234 1:21672880-21672902 GCTCTCCCCCAAGGGGCCACGGG + Intergenic
906294448 1:44640836-44640858 GCTCTCCAACACGGAGGGCAGGG - Intronic
906698437 1:47840488-47840510 GCTGTGGACCAGGGAGGGACAGG - Intronic
906775350 1:48524420-48524442 GCTCTCCACCCCAGAGGGACTGG + Intergenic
907472453 1:54682752-54682774 GCCCGTCACCAAGGAGGGCCGGG + Exonic
911645732 1:100335569-100335591 GCCCTCCACCAATGGGTGACAGG + Intergenic
916649600 1:166822530-166822552 GCTCTGAACCAAGCCGGGACGGG - Intergenic
917198816 1:172494599-172494621 CCTCTTCACCAAGGTGGGTCAGG - Intergenic
920809420 1:209268176-209268198 GCTCTTGACCAAGGAGGGAGTGG + Intergenic
923446040 1:234072437-234072459 TCTTTCTACCAAGGAGGGCCAGG - Intronic
1063160015 10:3412338-3412360 GCCCTCAACCAAGGAGAGGCAGG + Intergenic
1067280280 10:44865636-44865658 GCTCACCACTCAGGAGGCACGGG + Intergenic
1067297454 10:44982837-44982859 GTTCTCCAGGAAGGAGGGAGAGG - Intronic
1067479410 10:46585292-46585314 GCCCCCCAACAGGGAGGGACAGG + Intronic
1067615328 10:47756506-47756528 GCCCCCCAACAGGGAGGGACAGG - Intergenic
1068544506 10:58330845-58330867 GCTCGCCACCACAGAGGGAAAGG - Intergenic
1069961972 10:72084424-72084446 GCTCTCCACCCAGGAGGGGCCGG - Intronic
1070304512 10:75232206-75232228 GCTCTCCACACAGGAGGGTTGGG + Intergenic
1070934877 10:80285478-80285500 GGTCTCCAGCAGGGAGGGATCGG + Intronic
1071630730 10:87216457-87216479 GCCCCCCAACAGGGAGGGACAGG - Intergenic
1072860128 10:98994844-98994866 CCACTCTGCCAAGGAGGGACAGG - Intronic
1073106165 10:101033165-101033187 GCTCTCCTCCAATCAGGGACTGG + Intronic
1075669101 10:124251031-124251053 GCTCCAGACCAAGGTGGGACTGG + Intergenic
1076065125 10:127442382-127442404 GTTCTCCCCCAAGGAAGGGCAGG - Intronic
1076526040 10:131112887-131112909 ACCCTCAACCGAGGAGGGACGGG - Intronic
1077237575 11:1489075-1489097 GGTCGCAACCAAGGCGGGACGGG + Intronic
1079612982 11:22456176-22456198 GCTCTTCACCTGTGAGGGACAGG + Intergenic
1080588823 11:33703918-33703940 CCTCTCCAGCCAGGAGGGCCTGG + Intronic
1080589364 11:33708072-33708094 CCTCTCCAGCCAGGAGGGCCTGG + Intronic
1082044726 11:47715431-47715453 CCTCGCCCCCAAGGAGGGAGCGG + Intergenic
1083365234 11:62138286-62138308 GCTCTGCAGCAAGGAGGGAGGGG - Intronic
1083545952 11:63549585-63549607 TCTCCCCACCCAGGAGTGACGGG + Intergenic
1084590115 11:70085526-70085548 GCTCACCACCTGGGAGGGCCTGG - Intronic
1087071856 11:94089401-94089423 GGGGACCACCAAGGAGGGACAGG + Intronic
1088974034 11:114798898-114798920 GCTCTCCACCTTTGAGGGAGGGG - Intergenic
1090788541 11:130070232-130070254 GCACTGCGCCAAGCAGGGACGGG - Intronic
1090976584 11:131684848-131684870 GCTCTTCACCATGGTGGGGCTGG - Intronic
1094375101 12:29781910-29781932 ACTCTCCAGCAAGTAGGCACAGG + Intronic
1094842308 12:34347256-34347278 GTTCTCGCCCAAGGAGGGGCTGG - Intergenic
1096541773 12:52312098-52312120 CCTCTACACCAAGGAGGGGGTGG - Intergenic
1098961900 12:76747560-76747582 GCTCTTCATCCTGGAGGGACTGG - Intergenic
1101814956 12:108138991-108139013 CCTCTGCACCAAGGTGGGACTGG + Intronic
1103830271 12:123773632-123773654 GCTCTCCACCATGGGAGGATAGG - Intronic
1104323234 12:127771965-127771987 GCCCACCACCAAGGAGGGAAGGG + Intergenic
1104410511 12:128553927-128553949 GAGCTGCAACAAGGAGGGACTGG - Intronic
1106054518 13:26226031-26226053 GATCTCACCCAATGAGGGACAGG - Intergenic
1109191245 13:59327027-59327049 GCTCTCAACCAAGGACAGAAGGG + Intergenic
1111236645 13:85417923-85417945 GTACTCCACCAATGAGGAACTGG + Intergenic
1112419205 13:99232378-99232400 TCTCTCAACTAAGGATGGACAGG - Intronic
1113599765 13:111560118-111560140 CCTCTGCAGGAAGGAGGGACAGG - Intergenic
1113885719 13:113657455-113657477 GCTTTCCTCCCAGGAGGGCCAGG + Intronic
1113932235 13:113974494-113974516 TCTCTCCACCAGGGAGGGCGGGG + Intergenic
1119071048 14:71584511-71584533 GCTTTCCTTGAAGGAGGGACTGG + Intronic
1119345710 14:73922139-73922161 ACTCTCCACCAAGGCTGGGCTGG - Exonic
1120835436 14:89035059-89035081 GAGCTCCACGAGGGAGGGACTGG - Intergenic
1121614154 14:95301620-95301642 GCTGCCCACCCAGGATGGACCGG + Intronic
1121638967 14:95472727-95472749 GCTCTCAACCCAGGAGCGATGGG + Intronic
1122284954 14:100645511-100645533 GCTCTGCAGTAATGAGGGACTGG + Intergenic
1122721394 14:103724385-103724407 GAGCTCCACCAAGGACAGACGGG - Intronic
1123010914 14:105349119-105349141 GCTCTACCCCAAGGAGGGGGCGG - Intronic
1130255962 15:82326212-82326234 GCTCACCAGCAGGGAGGGCCAGG - Intergenic
1130598993 15:85263774-85263796 GCTCACCAGCAGGGAGGGCCAGG + Intergenic
1131435596 15:92419115-92419137 CCTCTCCAGGAAGGAGGGAGTGG + Intronic
1132293181 15:100717447-100717469 GCTCTCCAGCTGGGAGGGAGGGG - Intergenic
1132553055 16:561047-561069 GCTCTCCCCCAAACAGGGACAGG + Intronic
1132846539 16:2003440-2003462 GCTCTACCCCCAGGAGGGCCTGG + Intronic
1133564340 16:6978931-6978953 GCTCTCCACCAAGATGGGTGTGG - Intronic
1133775172 16:8889882-8889904 CCTCACCACCAGGGAGGGGCTGG + Intergenic
1134084308 16:11345927-11345949 CAACTTCACCAAGGAGGGACCGG - Intronic
1134476910 16:14581938-14581960 GCTCTCCACCACGTAAGGACAGG + Intronic
1138531648 16:57637720-57637742 GCTCTGCTCCACGGAGGGGCGGG + Intronic
1140348972 16:74243452-74243474 ACCCTCAGCCAAGGAGGGACGGG - Intergenic
1140838822 16:78820148-78820170 TGTCTCCAGCAAGCAGGGACAGG - Intronic
1141581718 16:85003982-85004004 GCTCTCCACAAAGGAGCTAATGG + Intronic
1141843058 16:86586809-86586831 GCTCTGCACCAAGGATGACCTGG + Intergenic
1142737099 17:1907956-1907978 TCTCTCCACCAACCAGGGGCGGG + Intergenic
1143100485 17:4501847-4501869 GCTCCCCACCAAAGATGGAAGGG + Intronic
1143784231 17:9244864-9244886 GCTCTCCACACAGCAGGGAAGGG - Intergenic
1143837077 17:9701224-9701246 GTTCTACACCAAGGAGGAGCAGG + Exonic
1144753273 17:17664757-17664779 GCTTTCCTCCAAGGAGGCAGAGG + Intergenic
1145236932 17:21214686-21214708 GCCCGCCTCCAAGGAGGGCCCGG - Intergenic
1146180275 17:30693763-30693785 GCTCTCCCTCCAGGAGGGATGGG + Intergenic
1149852374 17:60045990-60046012 GCTTTCCACCAGGGAGTGAAGGG + Intronic
1149988468 17:61366631-61366653 CCTCTCCATCAAGTAGGGTCAGG - Intronic
1151584314 17:74999580-74999602 GTACTCCACCAATGAGGAACAGG + Exonic
1152593741 17:81228174-81228196 GCTTTCCTCAAAGGAGGGACAGG - Intergenic
1152610216 17:81311669-81311691 GCCCTCATCCAAGGACGGACAGG - Exonic
1152838618 17:82551866-82551888 GACCTCCTCCAAGGAGGGGCAGG + Intronic
1203166362 17_GL000205v2_random:100408-100430 ACTCTCCTCCAAGGAGGAAAAGG - Intergenic
1154201231 18:12302098-12302120 GCTAACTTCCAAGGAGGGACAGG - Intergenic
1155076128 18:22357157-22357179 GCTCTCCTCCAAGCAGCAACAGG + Intergenic
1157276468 18:46314275-46314297 GCTCTCAACCAATGACGGGCGGG + Intergenic
1157770188 18:50338926-50338948 GCTCTGCACCGAGCAGGGGCTGG + Intergenic
1158838008 18:61352045-61352067 GCTGTTCTCCAAGGAGGGAGTGG - Intronic
1161060058 19:2210387-2210409 GCTCTCCTTCCAGGAGGAACAGG + Exonic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1161963753 19:7536355-7536377 GGTCTCCATCAAGGAAGGAGCGG - Intronic
1162757878 19:12871146-12871168 ACCCTCCGCCAAGGAGGGCCAGG + Exonic
1162978325 19:14221777-14221799 GCTCTCCCTCCAGGAGGGATGGG - Intergenic
1164708587 19:30338727-30338749 GGACCCCACCAAGGAGGGGCTGG + Intronic
1164756737 19:30695346-30695368 GCTCTGCACACAGTAGGGACTGG - Intronic
1164822110 19:31258192-31258214 GCTCCCAACCAATGATGGACAGG - Intergenic
1166314232 19:41979893-41979915 GCTCTCAGCCAAAGAGAGACAGG - Intronic
1167804146 19:51767976-51767998 GCTCCACATCAAGCAGGGACAGG + Intronic
1168154109 19:54463687-54463709 GCTCTCCACCAAGGAGGGACTGG - Exonic
926071281 2:9894712-9894734 TCTCTCCTCCTGGGAGGGACAGG - Intronic
927211114 2:20639779-20639801 CCTCTCCACCAGAGAGGGGCTGG + Intronic
929795232 2:45053978-45054000 GCTGGCCAGCAAGGAGGGCCTGG - Intergenic
935195652 2:100814076-100814098 AGTCTCCACGAAGGAGGGCCAGG + Intergenic
937009602 2:118550766-118550788 GCCCTCAACCAATGAGGTACTGG - Intergenic
937283621 2:120736550-120736572 GCTCTCCCCCAGGTAGGGAGAGG - Intronic
937923039 2:127145857-127145879 TCTCACCAACAAGGAGGGCCAGG + Intergenic
938158406 2:128960584-128960606 GCTCTCTTCCAGGGAGGCACTGG - Intergenic
944216644 2:197263136-197263158 GCTCTTGACCAAGGAGGGAGTGG - Intronic
944905183 2:204255212-204255234 GCTCTTTACCAAGGGGGGATGGG - Intergenic
947012162 2:225578323-225578345 TCTCTTCACCAAGCAGGGAAGGG + Intronic
947496815 2:230643694-230643716 GTCTTCAACCAAGGAGGGACAGG + Intergenic
948320844 2:237067795-237067817 GCTCTCCCCCAAGGATGAAAGGG + Intergenic
948895851 2:240926509-240926531 GCCCTCCAGCAAAGGGGGACTGG + Intronic
1170208235 20:13822612-13822634 ACTCTCAACCAAGGAGAGAAAGG - Intergenic
1170395601 20:15921987-15922009 GCCCTCAACCAATGACGGACAGG - Intronic
1170585758 20:17732811-17732833 GCTCTGGCCCAAGGAGGGAAAGG + Intronic
1171159166 20:22906057-22906079 GCTCTCAAGCAGAGAGGGACAGG + Intergenic
1171233791 20:23508631-23508653 GCTCTCTCCCATGGAGGGACTGG + Intergenic
1174175040 20:48639214-48639236 CCTCTCCACCAAGGGAGGATGGG + Intronic
1174754095 20:53141088-53141110 GCTGACCACCAAGGAGGTTCTGG + Intronic
1174754183 20:53141686-53141708 ACACTCCACCAGGGAGGGCCCGG - Intronic
1176405393 21:6358688-6358710 ACTCTCCTCCAAGGAGGAAAAGG + Intergenic
1176431764 21:6630415-6630437 ACTCTCCTCCAAGGAGGAAAAGG - Intergenic
1178488036 21:33031101-33031123 GCTCCTCACCAAGTAGGGAAGGG + Intergenic
1178602320 21:34005313-34005335 GCTCTTTTCCAAGGAGGGAAAGG - Intergenic
1179425962 21:41278767-41278789 CAGCTCCACCAAGCAGGGACAGG - Intronic
1180995866 22:19964897-19964919 GCTGACCACCAGGGAGGGATGGG - Intronic
1182421913 22:30252709-30252731 GGGCTCCACCCAGGTGGGACGGG - Intergenic
1184941054 22:47765586-47765608 CCTGACCACCAAGGAGGGAGGGG + Intergenic
1185272214 22:49934831-49934853 GCTCTGCACCAGTGAGGGGCCGG + Intergenic
950169996 3:10832289-10832311 CCTCCCCACCAGGGAGGCACTGG + Intronic
950206331 3:11084091-11084113 GCTGGCCACCAAGGAGAGCCTGG + Intergenic
950612438 3:14134910-14134932 GCTCTCCAAATAGGAGGGTCAGG + Intronic
952849960 3:37719696-37719718 GTTTTCTACCAAGGAGAGACCGG + Intronic
953010508 3:39021139-39021161 GCGCTCCACCAAGAAGGTAAGGG + Intergenic
953193158 3:40708507-40708529 TTTCTCCACTTAGGAGGGACGGG + Intergenic
953580167 3:44146440-44146462 GCCCTCCAGCAAAGAGGCACAGG + Intergenic
954004380 3:47579381-47579403 GGTCTCCACGAGGGAGGGGCGGG + Exonic
954633957 3:52061511-52061533 GCTCCCCACCCAGCAGTGACAGG + Intergenic
955184192 3:56699400-56699422 GCTGTCCACGAATGAGGGAGTGG + Intergenic
959007226 3:101034052-101034074 CCTCTCCCCCAAAGAGGGAGTGG - Intergenic
959575371 3:107927712-107927734 GCGCTCCACCAAGCCGCGACAGG + Intergenic
960923060 3:122767894-122767916 TCTCTCCACAAAGAAGGGGCAGG + Intronic
961817819 3:129560320-129560342 GCTCTCCACCAAGGTGAGTCCGG - Exonic
963081798 3:141402117-141402139 GCCCCCCACCAAGGAGGCAGCGG - Intronic
967131358 3:186473595-186473617 GGTCTCCACCAAGGAGGCACAGG + Intergenic
967319824 3:188184348-188184370 GCTCCCCATCCAGGAGGGAAGGG + Intronic
968659782 4:1794171-1794193 GCTCTCCGGCAAGGAGGCAGCGG - Intronic
970106643 4:12593408-12593430 GCAACCCACCAAGGAGGCACTGG + Intergenic
986287963 5:6374377-6374399 GCTCTACACCAAAGAGTGCCTGG - Exonic
987038359 5:14039585-14039607 ACTCTGCACCAAGTAGGGGCTGG + Intergenic
987645945 5:20672459-20672481 ACTCTCCACCCAGAAGGGAAAGG + Intergenic
989150038 5:38290279-38290301 AGTCTCAACCAAGGAGGGATAGG - Intronic
999280462 5:150361967-150361989 GCTCTGCACCATGGTGAGACTGG + Intronic
1000204791 5:159048465-159048487 GCCCTCAACCAAGAGGGGACAGG + Intronic
1002516938 5:179765948-179765970 GCTCTCCACAAGTGAGGGCCGGG + Exonic
1002639219 5:180622761-180622783 GGTCTCCAACAAGGTGGGCCAGG - Exonic
1003123812 6:3339383-3339405 GCTGTCACCCCAGGAGGGACAGG - Intronic
1007072292 6:39046621-39046643 GCTGTCAACCATGGATGGACAGG - Intergenic
1007405664 6:41634775-41634797 GCTGGCCACCAAGGAGGGGTGGG + Intergenic
1007734255 6:43970829-43970851 AGTGTCCACCAAGGAGGGATGGG - Intergenic
1011394292 6:86890285-86890307 GCTCTCTAAGCAGGAGGGACTGG + Intergenic
1014306770 6:119752742-119752764 GCACTGCTCCAAGGAGGGAGAGG - Intergenic
1014307417 6:119759089-119759111 GCACTGCTCCAAGGAGGGAGAGG - Intergenic
1015561957 6:134525573-134525595 GCTCTCTGCCCAGGAGGGAAAGG + Intergenic
1016495916 6:144661541-144661563 GCTCTCCACTTAGAAGGGGCGGG + Intronic
1017213952 6:151887257-151887279 GCTCTTTACCAAAGAGAGACTGG + Intronic
1017587880 6:155947060-155947082 GCTCTGCCCCAAGCAGGGACTGG - Intergenic
1018694982 6:166383551-166383573 GCCCGCCACCCTGGAGGGACCGG - Intergenic
1018932418 6:168250061-168250083 ACTCTCGCCCAGGGAGGGACGGG + Intergenic
1019058499 6:169239624-169239646 GCCTTCCACAAAGGATGGACTGG + Exonic
1019537155 7:1535206-1535228 TTTCTCCACCAAGTTGGGACTGG - Intronic
1020242151 7:6404076-6404098 TGTCTCCACACAGGAGGGACAGG + Intergenic
1027799467 7:82733728-82733750 GCTCTCAACCAGGGATGGAGAGG - Intergenic
1028196398 7:87912575-87912597 ACTCTCCATTAAAGAGGGACTGG + Intergenic
1029583404 7:101453532-101453554 CTTCTCCACCAGGGAGGGGCTGG - Intronic
1030379410 7:108795241-108795263 GCTATCCCTCAAGGAGGAACTGG + Intergenic
1030384146 7:108847796-108847818 GCTGTCCACCAAAGTTGGACAGG + Intergenic
1033742351 7:144284741-144284763 TGTCTCCACCACGGAGGGATGGG + Intergenic
1033751551 7:144364873-144364895 TGTCTCCACCACGGAGGGATGGG - Exonic
1034123410 7:148649333-148649355 GCTCTCCACCTAGGCTGGACAGG + Intergenic
1035079509 7:156204260-156204282 CCTGTCCCCCAAGGAGGGAGGGG + Intergenic
1036116973 8:5969567-5969589 GCTCACCAGCAAGGACGGAGAGG - Intergenic
1038798149 8:30727551-30727573 GCTCTCCACCACGGCGGCCCTGG + Exonic
1043213123 8:77550692-77550714 GATATCCACAAAGGAGGGATAGG + Intergenic
1045362900 8:101449407-101449429 GCTCTCCTCCATGGAGGGGTGGG + Intergenic
1051339856 9:16101211-16101233 GCTCTCCACCTAGGGTGGCCAGG + Intergenic
1056444235 9:86649109-86649131 GCTCTTCAGCAAAGAGGGAGTGG - Intergenic
1056919354 9:90772443-90772465 GCCCTCCACCAATGACTGACAGG - Intergenic
1059317326 9:113437192-113437214 GCTATCTTCCCAGGAGGGACGGG - Intergenic
1059629939 9:116110596-116110618 GCTGTCCACCAATGGGGGACTGG + Intergenic
1060375779 9:123114494-123114516 GCTCTCCAGCCAGGAGTCACAGG - Intronic
1061818075 9:133207999-133208021 GCCCACCTCCAAGGAGGGGCTGG - Intronic
1062242379 9:135547355-135547377 GCCCACCTCCAAGGAGGGGCTGG + Intronic
1062258569 9:135644447-135644469 GCTTTCCACAGAGGTGGGACTGG + Intergenic
1203439775 Un_GL000195v1:178293-178315 ACTCTCCTCCAAGGAGGAAAAGG + Intergenic
1187283503 X:17881124-17881146 ACTCTCAACCAATGAGGGATGGG - Intergenic
1188683373 X:33039939-33039961 AATCTCCTCCAAGGAGAGACTGG + Intronic
1189047725 X:37611126-37611148 GCCCCCAACCAATGAGGGACAGG - Intronic
1189551588 X:42099129-42099151 GCTCTTGACCAATGAGGGAGAGG + Intergenic
1189580009 X:42396154-42396176 GCCCTCAACCAAAGAGAGACGGG - Intergenic
1190733962 X:53243081-53243103 GCTCTTCACTTAGGATGGACAGG + Intronic
1197411790 X:126124636-126124658 GCACTGCTCCAAGGAGGGAGTGG - Intergenic
1198177619 X:134172186-134172208 GCTCTCCACCTGCGAGGGGCGGG - Intergenic
1200061331 X:153485094-153485116 GGTGTCCACCATGGAGCGACCGG + Intronic
1200256231 X:154584750-154584772 GCGCTCCCCCAAGGACGGACAGG + Intergenic
1200261538 X:154619653-154619675 GCGCTCCCCCAAGGACGGACAGG - Intergenic
1200267520 X:154653950-154653972 GCGCTCCCCCAAGGACGGACAGG - Intergenic
1201569426 Y:15398359-15398381 ACTCATCACCAAGGTGGGACTGG - Intergenic