ID: 1168155131

View in Genome Browser
Species Human (GRCh38)
Location 19:54469783-54469805
Sequence GGAACTCCAGTGTCTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168155126_1168155131 21 Left 1168155126 19:54469739-54469761 CCGAGACAGGACGTGACTGACCA 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1168155131 19:54469783-54469805 GGAACTCCAGTGTCTAGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 153
1168155127_1168155131 1 Left 1168155127 19:54469759-54469781 CCAAGATCACAAAGCCAGCTCTA 0: 1
1: 0
2: 0
3: 25
4: 275
Right 1168155131 19:54469783-54469805 GGAACTCCAGTGTCTAGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168155131 Original CRISPR GGAACTCCAGTGTCTAGAGC TGG Intronic
900122466 1:1054679-1054701 GGAACTGCAGGGGCTACAGCGGG - Intronic
900342609 1:2195853-2195875 GGGCCTCCAGCATCTAGAGCAGG - Intronic
904746837 1:32716600-32716622 AGGACTCCAGTGCCAAGAGCTGG - Intergenic
907678490 1:56540973-56540995 AGAATTCCAGTGTCTAGCACTGG - Intronic
909497939 1:76300385-76300407 GGACCTTGATTGTCTAGAGCTGG - Intronic
910286705 1:85563875-85563897 AAAACTACAATGTCTAGAGCTGG + Intronic
913177618 1:116289270-116289292 GTAACTCCAGTGCCTAGAGCAGG + Intergenic
913532907 1:119745460-119745482 GGACACCCAGTGTCTAGATCTGG - Intergenic
916844948 1:168641155-168641177 GAATCTCCAGTGTCTGGACCCGG - Intergenic
918092017 1:181305269-181305291 GGAAGTCCAGTCTCTGGAGCAGG + Intergenic
918138527 1:181700114-181700136 GGCACTCCAATGTCTAGAGGAGG + Intronic
922434520 1:225590643-225590665 GGCACTCCAGTTTCTAGCTCGGG - Intronic
922775046 1:228210748-228210770 GGGACCCCAGAGTCTGGAGCTGG - Intronic
922955730 1:229597836-229597858 GGGACTCCATAGTCCAGAGCAGG - Intronic
923307560 1:232702144-232702166 GTAACCCCAGTGCCTAGAACAGG + Intergenic
923926809 1:238637885-238637907 GTATCCCCAGTGTCTAGACCTGG + Intergenic
924398990 1:243657245-243657267 GCAAATTCAGTGTCTAGAGAGGG - Intronic
1070272577 10:74970927-74970949 AGAACTCCATAGTATAGAGCAGG + Intronic
1070960750 10:80498611-80498633 AGAACACCAGTGTCAAGAGAAGG + Intronic
1074131649 10:110584282-110584304 GGAACTCAAGTCTTTAGATCAGG + Exonic
1074454100 10:113582411-113582433 GGATCTCCAGTGTCTTGAGCAGG + Intronic
1074955616 10:118385689-118385711 GCATCTCCAGTGTCTAGCACAGG - Intergenic
1080280325 11:30549720-30549742 GAACCTCCAGAGACTAGAGCTGG - Intronic
1080625524 11:34027500-34027522 GGAACTCTAATGTATATAGCTGG - Intergenic
1083566517 11:63722948-63722970 AGAACTCCAGTGTCTAATTCTGG + Intronic
1083764888 11:64836952-64836974 GAAGCTCCAGTGTCTGGAGCAGG - Exonic
1084781743 11:71414310-71414332 GGAACACCAGAGTCCTGAGCAGG - Intergenic
1086012059 11:82117113-82117135 TGAAGTCAAGTGACTAGAGCAGG - Intergenic
1088868665 11:113873398-113873420 GGAACTCCAGTGGCTGTGGCTGG - Intronic
1090636817 11:128694657-128694679 GGAAGCCCAGTGCCTAGCGCTGG - Intronic
1090636877 11:128694891-128694913 GGCTCTCCAGCGCCTAGAGCCGG - Intronic
1091159108 11:133403503-133403525 GGAACTCCAGGGTCTTGGGAAGG + Intronic
1091175964 11:133558029-133558051 GCAGCTGCAGTGTCTAGAACTGG + Intergenic
1091288844 11:134425403-134425425 GGCAATCCAGGGTCTACAGCTGG + Intergenic
1092781575 12:11992555-11992577 GGAGCTCCAGTGTCCAAAGGCGG + Intergenic
1095656183 12:44672083-44672105 GCAGCTTCAGTGTCTAGAACAGG + Intronic
1096524775 12:52203915-52203937 GGAACCACAGGGTCCAGAGCAGG + Intergenic
1096615347 12:52829787-52829809 GCTACTCCAGTGGCTAAAGCAGG + Intronic
1102026166 12:109715197-109715219 GGAACTCCAGTGTCTTGGAAGGG + Intronic
1104164179 12:126210743-126210765 GGAAATCCAAAGTCCAGAGCAGG - Intergenic
1104656231 12:130575578-130575600 GGATCCCCAGTGCCTAGAACAGG - Intronic
1109104934 13:58239156-58239178 GGAACTGCTGGGTCTAAAGCTGG - Intergenic
1112337045 13:98524402-98524424 GCCTCTCCAGTGTCTAGAACAGG - Intronic
1112665853 13:101572385-101572407 GGAGGTCCAGTGTGCAGAGCAGG + Intronic
1115223574 14:31081236-31081258 GGAAATCCAGTTTCTGGAGGAGG - Intronic
1116450460 14:45059184-45059206 GGTACTCCAGTGGCTAAAACAGG - Intronic
1118816374 14:69317138-69317160 GGATCTCCAGTCTCTTGAGCTGG + Intronic
1119467904 14:74873885-74873907 GGAACTGCAGTGTGAGGAGCAGG + Intergenic
1120827648 14:88969922-88969944 GAAAGTCCAGTGGCCAGAGCTGG - Intergenic
1125758676 15:42083021-42083043 GGACCACCAGTGGCCAGAGCGGG - Intronic
1128739069 15:70071325-70071347 GGAACTCAAGTGTCTACCGAGGG - Intronic
1137482295 16:48862460-48862482 GGAATTCCACTGTTCAGAGCTGG - Intergenic
1137661383 16:50209951-50209973 GCAACTTCAGGGTCCAGAGCAGG - Intronic
1139533436 16:67556090-67556112 GAATCTCCAGTGCCTAGAACAGG + Intergenic
1141646335 16:85370017-85370039 GTAACTCCCGAGTTTAGAGCTGG + Intergenic
1147614277 17:41819286-41819308 GGAGCTCCAGCGTCTCTAGCTGG - Exonic
1149210926 17:54299518-54299540 GTAGCTCAAGTGTCTAGAACAGG - Intergenic
1151170855 17:72245056-72245078 TGAGATCCATTGTCTAGAGCAGG + Intergenic
1152407894 17:80107945-80107967 GGACCTCCAGTCTCCAGGGCAGG - Intergenic
1153374311 18:4358101-4358123 TTATCTCCAGTGTCTAGAACAGG - Intronic
1153374485 18:4359799-4359821 TTATCTCCAGTGTCTAGAACAGG - Intronic
1156520455 18:37717813-37717835 GGAAGTGCAGGGTCTGGAGCTGG + Intergenic
1157480698 18:48051758-48051780 GCAACTGCAGGGTCAAGAGCTGG + Intronic
1160852993 19:1202803-1202825 GGAAATTCAGTGTGTAGGGCAGG + Intronic
1161816057 19:6500930-6500952 GGATCTCCAGCTTCTAGAACAGG + Intronic
1162183626 19:8888030-8888052 GGGACTCCAGTTTCTAAACCTGG - Exonic
1162846727 19:13398479-13398501 GGATCTCTGGTGTCTAGAACAGG + Intronic
1164057874 19:21637543-21637565 TGAACTCCAGTATTTAGAGATGG - Intergenic
1164071058 19:21768541-21768563 TGAACTCCAGTATTTAGAGATGG + Intergenic
1165121645 19:33562845-33562867 GGAACTCCAGAGTCCAGAGATGG + Intergenic
1165714805 19:38037443-38037465 GTAACTGCAGGGTCAAGAGCTGG + Intronic
1166719368 19:44988441-44988463 GGAACTCCAGAGCCAAGAGCAGG + Intronic
1167343994 19:48933855-48933877 GGGACTCCAGAGTCTAAAGGAGG + Intronic
1167376579 19:49115196-49115218 TGAACTCCTGCGTCTAGGGCTGG + Intronic
1167863989 19:52309254-52309276 GGACCTCCAGAGTCTCCAGCTGG - Intronic
1168155131 19:54469783-54469805 GGAACTCCAGTGTCTAGAGCTGG + Intronic
925910863 2:8572867-8572889 GGAGCAGCAGGGTCTAGAGCTGG + Intergenic
928219515 2:29391796-29391818 GGAACTCAAGTGATGAGAGCAGG - Intronic
929577581 2:43062108-43062130 AGAGCTCCAGTGGCTAAAGCTGG - Intergenic
930019991 2:46995774-46995796 GCATCTCTGGTGTCTAGAGCAGG - Intronic
930578822 2:53185195-53185217 GGAAGTCAACTGTCTAGGGCTGG - Intergenic
930698544 2:54436043-54436065 GTAAATCCAATGTCTACAGCTGG - Intergenic
931561193 2:63562797-63562819 GGAACTCCAGTGGCCAAATCTGG - Intronic
932589811 2:73058646-73058668 GGCTCTCCAGTGTCTGGAGAAGG - Intronic
932873262 2:75425178-75425200 TGGACTCCAGTGTCCAGAGAAGG + Intergenic
933291664 2:80444809-80444831 GGACCTCCAGCCTCTAGAACTGG + Intronic
933466774 2:82661426-82661448 GGGACTTCAGAGTCTAGTGCCGG - Intergenic
935575272 2:104702763-104702785 GAAACCCCAGTTTCAAGAGCTGG - Intergenic
935650919 2:105381387-105381409 GGAACCCCAGTGTATAGACATGG + Intronic
937137252 2:119564243-119564265 GGAACTCCAAAGTTTAGATCTGG + Intronic
939577868 2:143917740-143917762 GGAGCTGCAGTGTCCAGAGGTGG - Intergenic
946448989 2:219763709-219763731 GGAACTCCAGCCTCCAGAACTGG - Intergenic
948625756 2:239266916-239266938 GGACCTCCAGTGGTTAGGGCTGG - Intronic
1168902337 20:1375711-1375733 GGAACTGCAGTATCTAGGGAGGG + Intronic
1169021764 20:2335795-2335817 GTAACTCCAGGGTCTAGACAGGG - Intronic
1170284518 20:14691614-14691636 GGAAATGCAGTTTCTAGAGCAGG + Intronic
1175254416 20:57630607-57630629 GAAAAGCCAGAGTCTAGAGCTGG - Intergenic
1175527340 20:59644525-59644547 GGGACTCCAGGGTCTAGCACTGG + Intronic
1181412102 22:22731249-22731271 GGAACTCCAGAGGCTCCAGCAGG + Intergenic
1182549993 22:31095726-31095748 GGAACTGCTGGGTCTAGAGAAGG - Intronic
1184902107 22:47452867-47452889 GGAACACCAGTGTCTGGTGTTGG - Intergenic
950140803 3:10613799-10613821 GGAACTCGAGGGTCTTGAGTGGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
955060895 3:55490405-55490427 GGAACTCCAGATTCCACAGCTGG - Intergenic
955797798 3:62655748-62655770 TGAGCTCCAGTGTCTAGCACCGG - Intronic
956290901 3:67658612-67658634 GCACCTCCAGTGTCTAGCACTGG + Intergenic
957209061 3:77236983-77237005 GCTACTCCAGTGTCTGGAGTTGG - Intronic
957959032 3:87226701-87226723 GGGGATCCAGTGTCTAGAGTTGG - Intergenic
958461610 3:94405030-94405052 GGACCTCCAGTTTCTACAGTGGG - Intergenic
964661174 3:159122014-159122036 GGAACTCCAGACTCCAAAGCTGG - Intronic
968129615 3:196185155-196185177 GCAACTGCAGCCTCTAGAGCTGG + Intergenic
972177024 4:36420319-36420341 GGGACTCCAGTGTCCAGATGAGG - Intergenic
978765250 4:112398713-112398735 GGAACACCAGAGGCAAGAGCAGG + Intronic
980169815 4:129275606-129275628 GGAACTCCAATGTCTAGGACAGG - Intergenic
982739407 4:159042244-159042266 GGACCTCCAGAGACTTGAGCTGG - Intergenic
988983366 5:36593878-36593900 GGCTCTCCAATGTCTAGAGGTGG - Intergenic
988998830 5:36740544-36740566 GGGACTCTGGTGTCCAGAGCAGG - Intergenic
994046999 5:95321437-95321459 GGAAGTGAAGTGTCTAGAGAGGG + Intergenic
996478449 5:123947665-123947687 GGAATTCCAGTGCCTAGAACAGG + Intergenic
1000013307 5:157254028-157254050 GGAACTAGAAAGTCTAGAGCTGG + Exonic
1003027364 6:2567375-2567397 AGAACTCCAGTGCCCAAAGCTGG - Intergenic
1003495085 6:6656764-6656786 GGCACTCCAATGTCTGAAGCTGG - Intergenic
1005074722 6:21895925-21895947 GTAACCCCAGTGCCTAGAGCAGG + Intergenic
1011201743 6:84844608-84844630 TTATCTCCAGTGTTTAGAGCAGG - Intergenic
1011852011 6:91640730-91640752 GGAACTCCAGAGTCTATTGAAGG + Intergenic
1013130027 6:107223826-107223848 GAAATCCCAGAGTCTAGAGCAGG + Intronic
1014696075 6:124622874-124622896 TGAACTCCAGGCTCCAGAGCAGG - Intronic
1015580991 6:134725113-134725135 GGAGCGCCAGTGTCTGGCGCGGG - Intergenic
1016705134 6:147098022-147098044 AGATCTCCAGGGTCTGGAGCTGG + Intergenic
1018999817 6:168740731-168740753 AGAACTCAACTGTCTAGAGTGGG - Intergenic
1019466662 7:1193447-1193469 GTAGCTCCAGTGCCTGGAGCAGG + Intergenic
1020388013 7:7628865-7628887 GGCTCTCCACTGACTAGAGCAGG - Intergenic
1021534635 7:21689507-21689529 GGACCTCCAGAGGGTAGAGCTGG - Intronic
1023600448 7:41877050-41877072 GGAAGTCCAGTGTTGAGAGCCGG + Intergenic
1024880323 7:54078463-54078485 GAAGCTCCAGTGCCCAGAGCTGG - Intergenic
1030632148 7:111907660-111907682 GGGGGTCCAGTGACTAGAGCTGG + Intronic
1031330097 7:120453385-120453407 GGACCACCAGTGTCATGAGCTGG - Intronic
1031979445 7:128115355-128115377 GGACCACCAGTTTCTAGAGATGG + Intergenic
1032738253 7:134712506-134712528 ACAACTCCAGTGTCTTGAGCAGG - Intergenic
1034539341 7:151746210-151746232 GGATTTCCAGTGTCTGGACCTGG + Intronic
1035552149 8:537055-537077 GGAACTCTGGAGTCTGGAGCGGG - Intronic
1037990684 8:23319598-23319620 TGAACCCCAGTGTGCAGAGCAGG + Intronic
1039841283 8:41294987-41295009 GAAACTCCAGCATCTGGAGCTGG + Intronic
1049444453 8:142623640-142623662 AGAAGTCCAGTGGCTAGGGCGGG - Intergenic
1049681881 8:143922620-143922642 GGATCTCCAGTGTCTGCACCAGG + Exonic
1053080865 9:35175393-35175415 GGAACTCCAGTGTATAGGAATGG + Intronic
1053381008 9:37650134-37650156 GTATCTCCAGTGTCTAATGCAGG + Intronic
1055322121 9:75092391-75092413 GGAACCCCAGTGTCTAGCACAGG - Intronic
1057313975 9:93957552-93957574 GGGACTCCAGTGAGTAGGGCTGG + Intergenic
1058412805 9:104751894-104751916 GTTACTCCAGTGTCTACATCAGG + Intronic
1058653066 9:107195214-107195236 GGCACTCCAATGTCGAGGGCAGG + Intergenic
1059436115 9:114277447-114277469 GGAAAAACAGTGTCAAGAGCAGG - Intronic
1060017990 9:120104017-120104039 GGGACTCCAGGGTCAAGAGTGGG + Intergenic
1060107578 9:120883232-120883254 GGATCTCCAGTGTCTGGTGAAGG - Intronic
1061534710 9:131240323-131240345 GGAAATCCCGGGTCTAGAGAAGG + Intergenic
1185764063 X:2710225-2710247 GAAACTCCAGTGTCAGGAGGTGG - Intronic
1186808523 X:13163843-13163865 GGAACTCCAGAGGCTACATCTGG + Intergenic
1187039092 X:15574348-15574370 GGAGCTCAAGTCTCTAGGGCAGG - Intronic
1189592043 X:42523699-42523721 GGAACTCATGTGCCTTGAGCTGG - Intergenic
1190457934 X:50643597-50643619 CGAAAGCCAGTGTCAAGAGCTGG + Intronic
1190839835 X:54133723-54133745 GGAAGTACAGTGTTAAGAGCAGG + Intronic
1190866089 X:54385824-54385846 TGAAATCCAGTATGTAGAGCTGG + Intergenic
1192609048 X:72549258-72549280 GGGACTCCAGTGTTTAAAACGGG - Intronic
1194016167 X:88624449-88624471 GGAACTCCAGTTTCGACTGCTGG - Intergenic
1198088780 X:133306885-133306907 GCTACTCCAGAGTCTAAAGCAGG - Intronic
1198267742 X:135025131-135025153 GGAACTATAGTGTGTAAAGCTGG + Intergenic
1199265825 X:145824253-145824275 GGAACTTCAGTGTGTAGTTCAGG - Exonic
1199993840 X:153006502-153006524 GGAACTCCAGTTACAAGAGGGGG + Intergenic
1202575242 Y:26317168-26317190 TGAGCTCCAGTGTTTAGAGAAGG - Intergenic